Incidental Mutation 'R6634:Lpin2'
ID525418
Institutional Source Beutler Lab
Gene Symbol Lpin2
Ensembl Gene ENSMUSG00000024052
Gene Namelipin 2
Synonyms2610511G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R6634 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location71182560-71249817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71246418 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 812 (D812E)
Ref Sequence ENSEMBL: ENSMUSP00000119282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125665
Predicted Effect probably damaging
Transcript: ENSMUST00000126681
AA Change: D850E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052
AA Change: D850E

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129635
AA Change: D812E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052
AA Change: D812E

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133156
Predicted Effect probably benign
Transcript: ENSMUST00000154507
SMART Domains Protein: ENSMUSP00000127035
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_mid 1 55 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,236,930 probably null Het
Alox12b C A 11: 69,168,821 Y566* probably null Het
Chl1 T A 6: 103,690,259 S403R probably damaging Het
Cpa5 T A 6: 30,626,364 D241E probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2t4 C A 7: 27,155,788 C121* probably null Het
Dkkl1 C A 7: 45,210,458 R56L possibly damaging Het
Ebf3 A G 7: 137,201,160 V387A probably damaging Het
Fer1l5 A G 1: 36,411,385 T1212A probably damaging Het
Galnt16 T A 12: 80,519,170 M1K probably null Het
Gm11639 T C 11: 104,893,783 M2797T probably benign Het
Gm5800 A G 14: 51,716,138 S7P possibly damaging Het
Gstp1 T A 19: 4,035,510 H199L probably benign Het
Herc1 T C 9: 66,437,744 S1940P probably benign Het
Igkv8-24 C T 6: 70,217,381 W14* probably null Het
Iqcd C A 5: 120,600,491 Q125K probably benign Het
Ltb4r2 T A 14: 55,762,505 probably null Het
Morc2a T C 11: 3,672,376 probably null Het
Myh1 A T 11: 67,209,064 N600I possibly damaging Het
Nedd9 T A 13: 41,312,108 K685N probably damaging Het
Olfr432 A G 1: 174,050,969 I199V probably benign Het
Otogl A C 10: 107,862,304 V735G probably damaging Het
Pcnx T A 12: 81,917,882 Y274* probably null Het
Pias1 A T 9: 62,919,424 I252N probably damaging Het
Pitpnm3 T C 11: 72,051,929 D844G probably null Het
Satb2 G T 1: 56,845,721 S348* probably null Het
Sfxn1 T A 13: 54,093,029 V180D probably damaging Het
Slc35g3 A T 11: 69,760,283 V314D probably damaging Het
Tmem200c C A 17: 68,842,106 D561E probably benign Het
Usp53 T A 3: 122,964,286 Q69L probably benign Het
Other mutations in Lpin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lpin2 APN 17 71243972 missense probably damaging 1.00
IGL01712:Lpin2 APN 17 71215068 missense probably damaging 1.00
IGL01727:Lpin2 APN 17 71246452 missense probably damaging 1.00
IGL01969:Lpin2 APN 17 71231507 missense probably benign 0.00
IGL02143:Lpin2 APN 17 71243926 missense probably damaging 1.00
IGL02600:Lpin2 APN 17 71238698 missense probably damaging 0.99
IGL02931:Lpin2 APN 17 71238683 missense probably damaging 1.00
aspen UTSW 17 71243970 nonsense probably null
R1570_Lpin2_218 UTSW 17 71245181 nonsense probably null
R0144:Lpin2 UTSW 17 71225076 missense probably damaging 1.00
R0165:Lpin2 UTSW 17 71246519 missense probably damaging 1.00
R0367:Lpin2 UTSW 17 71215022 missense probably damaging 1.00
R0648:Lpin2 UTSW 17 71229312 missense probably benign 0.01
R1564:Lpin2 UTSW 17 71225060 missense probably benign 0.01
R1570:Lpin2 UTSW 17 71245181 nonsense probably null
R1846:Lpin2 UTSW 17 71225069 missense probably benign 0.00
R3607:Lpin2 UTSW 17 71229392 missense probably damaging 1.00
R4006:Lpin2 UTSW 17 71246501 missense probably damaging 1.00
R4526:Lpin2 UTSW 17 71237378 splice site probably null
R4705:Lpin2 UTSW 17 71232143 unclassified probably benign
R4949:Lpin2 UTSW 17 71231339 missense probably damaging 1.00
R4970:Lpin2 UTSW 17 71231334 missense probably damaging 0.98
R5099:Lpin2 UTSW 17 71243970 nonsense probably null
R5100:Lpin2 UTSW 17 71243970 nonsense probably null
R5101:Lpin2 UTSW 17 71243970 nonsense probably null
R5152:Lpin2 UTSW 17 71245159 missense probably damaging 1.00
R5216:Lpin2 UTSW 17 71242760 missense probably damaging 1.00
R5321:Lpin2 UTSW 17 71246858 missense probably damaging 1.00
R5457:Lpin2 UTSW 17 71243372 missense probably damaging 1.00
R5695:Lpin2 UTSW 17 71244803 missense probably damaging 1.00
R5786:Lpin2 UTSW 17 71230273 missense probably benign 0.03
R5869:Lpin2 UTSW 17 71232276 unclassified probably benign
R5894:Lpin2 UTSW 17 71246934 missense probably benign 0.39
R6116:Lpin2 UTSW 17 71243930 missense probably damaging 1.00
R6253:Lpin2 UTSW 17 71231269 missense probably damaging 1.00
R6280:Lpin2 UTSW 17 71232248 unclassified probably benign
R6443:Lpin2 UTSW 17 71241668 missense probably benign 0.25
R6528:Lpin2 UTSW 17 71244005 missense probably damaging 1.00
R6828:Lpin2 UTSW 17 71222128 missense probably damaging 1.00
R6885:Lpin2 UTSW 17 71215150 missense probably damaging 1.00
R6930:Lpin2 UTSW 17 71244791 missense probably damaging 1.00
R7067:Lpin2 UTSW 17 71244858 missense possibly damaging 0.72
R7583:Lpin2 UTSW 17 71231396 nonsense probably null
R7806:Lpin2 UTSW 17 71245171 missense probably damaging 1.00
R7840:Lpin2 UTSW 17 71230274 missense probably benign 0.14
R8011:Lpin2 UTSW 17 71230375 missense probably benign 0.43
R8553:Lpin2 UTSW 17 71231237 missense probably damaging 1.00
R8879:Lpin2 UTSW 17 71242754 missense probably damaging 1.00
R8947:Lpin2 UTSW 17 71204876 missense probably benign 0.44
Z1176:Lpin2 UTSW 17 71225211 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTGGTTCTGAGCCATACC -3'
(R):5'- TGGCTCTCATCTGTGCTCAG -3'

Sequencing Primer
(F):5'- TTGGGTCCACACCAGAACTGTG -3'
(R):5'- GTGCTCAGCTATAACCTGGC -3'
Posted On2018-06-22