Incidental Mutation 'R6636:Stk17b'
ID525423
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Nameserine/threonine kinase 17b (apoptosis-inducing)
Synonyms3110009A03Rik, Drak2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53755506-53785224 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53761088 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 244 (Y244N)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
Predicted Effect probably damaging
Transcript: ENSMUST00000027263
AA Change: Y244N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: Y244N

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187066
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53764140 missense probably damaging 0.99
IGL00767:Stk17b APN 1 53764023 splice site probably benign
IGL01012:Stk17b APN 1 53761037 missense probably benign 0.06
IGL01431:Stk17b APN 1 53765915 splice site probably benign
IGL01914:Stk17b APN 1 53761067 missense probably damaging 0.98
IGL02236:Stk17b APN 1 53764088 missense probably damaging 1.00
IGL02827:Stk17b APN 1 53776542 missense probably benign 0.03
R0013:Stk17b UTSW 1 53764132 missense probably benign 0.36
R0545:Stk17b UTSW 1 53762583 splice site probably benign
R0831:Stk17b UTSW 1 53757492 missense probably damaging 1.00
R1035:Stk17b UTSW 1 53762599 missense probably benign 0.22
R1375:Stk17b UTSW 1 53765947 missense possibly damaging 0.83
R1576:Stk17b UTSW 1 53757590 missense probably damaging 1.00
R1809:Stk17b UTSW 1 53765981 missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53761082 missense probably damaging 1.00
R2033:Stk17b UTSW 1 53761076 missense probably damaging 1.00
R2105:Stk17b UTSW 1 53776605 missense probably benign 0.01
R2255:Stk17b UTSW 1 53776572 missense probably benign 0.00
R4395:Stk17b UTSW 1 53764115 missense probably damaging 0.98
R4521:Stk17b UTSW 1 53764038 missense probably damaging 1.00
R4777:Stk17b UTSW 1 53771708 missense probably damaging 1.00
R4871:Stk17b UTSW 1 53757534 missense probably benign 0.14
R4892:Stk17b UTSW 1 53771611 missense probably damaging 0.99
R4999:Stk17b UTSW 1 53761147 unclassified probably null
R5122:Stk17b UTSW 1 53776558 missense probably damaging 1.00
R5621:Stk17b UTSW 1 53771784 nonsense probably null
R6924:Stk17b UTSW 1 53761059 missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53757515 missense probably benign
R7322:Stk17b UTSW 1 53765945 missense probably benign 0.16
R7671:Stk17b UTSW 1 53766000 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCGTCTTTAGCAGGCACAC -3'
(R):5'- TCTGTGGTACAGTAATCTCTAGAAG -3'

Sequencing Primer
(F):5'- GTCTTTAGCAGGCACACATTATTTGG -3'
(R):5'- TTGCCAGACTTGTGGACT -3'
Posted On2018-06-22