Mutagenetix > Incidental Mutation

Incidental Mutation 'R6636:Lamc1'

525427

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6636 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 153241975 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 947 (I947N)

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027752
AA Change: I947N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: I947N

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163011

SMART Domains

Protein: ENSMUSP00000124216
Gene: ENSMUSG00000026478

Domain	Start	End	E-Value	Type
coiled coil region	1	93	N/A	INTRINSIC

Meta Mutation Damage Score

0.0980

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.8%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	A	G	15: 64,787,402	V513A	probably damaging	Het
Adgrl4	G	A	3: 151,517,773	W621*	probably null	Het
Ap4m1	A	G	5: 138,172,175		probably benign	Het
Atp6v1b2	T	C	8: 69,101,374	Y68H	probably damaging	Het
AY761185	T	A	8: 20,944,540		probably null	Het
C3ar1	T	C	6: 122,851,054	D68G	probably damaging	Het
Cdh10	A	T	15: 18,985,173	I308F	probably damaging	Het
Coq8a	A	T	1: 180,178,987	S112T	probably benign	Het
Diexf	A	T	1: 193,113,767	F197I	probably damaging	Het
Dmgdh	A	T	13: 93,709,198	E453D	probably benign	Het
Fryl	C	A	5: 73,133,312	R83L	probably benign	Het
Gm4861	C	T	3: 137,550,999		probably null	Het
Gnai1	T	C	5: 18,273,474	D231G	probably damaging	Het
Hfe	C	G	13: 23,706,795	E120D	possibly damaging	Het
Hfe	T	C	13: 23,706,796	E120G	possibly damaging	Het
Hgd	A	G	16: 37,615,374	N149S	possibly damaging	Het
Kcnb1	T	C	2: 167,105,854	D358G	probably damaging	Het
Lama2	C	A	10: 27,124,568	V1653L	probably benign	Het
Lamp3	A	G	16: 19,701,233	F67L	probably benign	Het
Ltbp2	T	C	12: 84,875,838	I132V	probably benign	Het
Muc4	C	T	16: 32,753,964	P1280L	probably benign	Het
Muc5ac	T	C	7: 141,818,605	Y2659H	possibly damaging	Het
Nmbr	T	C	10: 14,770,234	S168P	probably benign	Het
Nsl1	A	G	1: 191,075,127	T168A	probably benign	Het
Olfr1197	T	C	2: 88,728,841	I253V	probably benign	Het
Olfr130	G	A	17: 38,067,224	D18N	probably damaging	Het
Olfr1467	T	C	19: 13,365,225	V199A	probably benign	Het
Olfr284	A	G	15: 98,340,950	F13S	probably benign	Het
Pde1c	A	C	6: 56,180,102	V191G	probably damaging	Het
Proc	T	A	18: 32,123,760	I285F	probably benign	Het
R3hdm1	GAA	GAAA	1: 128,162,811		probably null	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Spa17	A	T	9: 37,611,974	S6T	probably benign	Het
Spp1	T	C	5: 104,440,530	V267A	possibly damaging	Het
Stk17b	A	T	1: 53,761,088	Y244N	probably damaging	Het
Tal1	A	G	4: 115,068,592	N286S	probably damaging	Het
Tgm7	T	A	2: 121,101,090	R197S	probably damaging	Het
Tmcc3	T	A	10: 94,578,424	V27E	probably benign	Het
Topaz1	A	T	9: 122,749,786	Q587L	probably benign	Het
Trim33	C	T	3: 103,353,719	A1061V	probably damaging	Het
Ttll1	C	G	15: 83,499,946	W160S	probably damaging	Het
Wnt7a	A	G	6: 91,394,558	Y141H	probably benign	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTCTTTCGTGGCCACAGAG -3'
(R):5'- AGACAGACTCATCAGGGCTG -3'

Sequencing Primer
(F):5'- TAACTGGCATGGGAGACA -3'
(R):5'- AGTCTGTCCAGTTCTCTGTCAGTAG -3'

Posted On

2018-06-22