Incidental Mutation 'R6603:Miip'
ID 525434
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R6603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 147860778-147868816 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 147865923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 72 (K72T)
Ref Sequence ENSEMBL: ENSMUSP00000134085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000094481] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect possibly damaging
Transcript: ENSMUST00000030886
AA Change: K72T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: K72T

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094481
SMART Domains Protein: ENSMUSP00000092054
Gene: ENSMUSG00000070583

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
coiled coil region 86 116 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119975
AA Change: K72T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: K72T

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156374
Predicted Effect possibly damaging
Transcript: ENSMUST00000172710
AA Change: K72T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: K72T

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174081
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,665,502 F167Y possibly damaging Het
Ap3d1 A G 10: 80,714,047 S755P probably benign Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Fbxl8 A T 8: 105,268,210 D118V probably damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lonrf1 T A 8: 36,222,941 R654S probably damaging Het
Lrrc49 A C 9: 60,593,769 probably null Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tas2r113 A T 6: 132,893,458 I150L probably benign Het
Tmem59l G A 8: 70,486,356 P56L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Txndc16 A G 14: 45,151,767 F492S probably damaging Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Xrcc1 C T 7: 24,571,034 Q500* probably null Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147865865 missense probably damaging 1.00
IGL02134:Miip APN 4 147865278 splice site probably benign
IGL02829:Miip APN 4 147863061 missense probably benign 0.01
IGL03350:Miip APN 4 147862522 missense probably benign 0.01
R0200:Miip UTSW 4 147862263 missense probably damaging 0.99
R1647:Miip UTSW 4 147865234 missense probably benign 0.02
R1783:Miip UTSW 4 147865774 missense probably damaging 1.00
R1848:Miip UTSW 4 147863092 missense probably damaging 0.99
R1944:Miip UTSW 4 147865965 missense probably benign 0.15
R3615:Miip UTSW 4 147865914 missense probably benign 0.00
R3616:Miip UTSW 4 147865914 missense probably benign 0.00
R3882:Miip UTSW 4 147861052 missense possibly damaging 0.93
R4579:Miip UTSW 4 147861061 missense probably damaging 1.00
R5183:Miip UTSW 4 147863069 missense probably damaging 1.00
R6054:Miip UTSW 4 147865678 missense probably benign 0.00
R6056:Miip UTSW 4 147862335 missense probably damaging 1.00
R6304:Miip UTSW 4 147863083 missense probably benign 0.12
R6568:Miip UTSW 4 147865915 missense probably benign
R7639:Miip UTSW 4 147862564 missense probably benign 0.22
R7701:Miip UTSW 4 147862914 missense probably null 0.86
R7795:Miip UTSW 4 147862918 missense probably benign 0.17
R7796:Miip UTSW 4 147862918 missense probably benign 0.17
R7797:Miip UTSW 4 147862918 missense probably benign 0.17
R7872:Miip UTSW 4 147862918 missense probably benign 0.17
R7920:Miip UTSW 4 147862918 missense probably benign 0.17
R8468:Miip UTSW 4 147861471 missense probably damaging 1.00
R8492:Miip UTSW 4 147861424 missense probably damaging 1.00
R8677:Miip UTSW 4 147863046 missense probably damaging 1.00
R8852:Miip UTSW 4 147866382 start gained probably benign
R8860:Miip UTSW 4 147866382 start gained probably benign
R9755:Miip UTSW 4 147865862 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTTGTCAGGTCCCAGAC -3'
(R):5'- CAGCAGGGTAAATTACAAGGTCC -3'

Sequencing Primer
(F):5'- TGGTCCTCCCAAAGACACTGG -3'
(R):5'- GGTAAATTACAAGGTCCACAGC -3'
Posted On 2018-06-22