Incidental Mutation 'R6636:Kcnb1'
ID525439
Institutional Source Beutler Lab
Gene Symbol Kcnb1
Ensembl Gene ENSMUSG00000050556
Gene Namepotassium voltage gated channel, Shab-related subfamily, member 1
SynonymsKcr1-1, Shab, Kv2.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6636 (G1)
Quality Score221.009
Status Validated
Chromosome2
Chromosomal Location167095969-167190155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167105854 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 358 (D358G)
Ref Sequence ENSEMBL: ENSMUSP00000147093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059826] [ENSMUST00000207917]
Predicted Effect probably damaging
Transcript: ENSMUST00000059826
AA Change: D358G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057981
Gene: ENSMUSG00000050556
AA Change: D358G

DomainStartEndE-ValueType
BTB 31 140 1.3e-14 SMART
low complexity region 150 162 N/A INTRINSIC
Pfam:Ion_trans 188 424 2.4e-50 PFAM
Pfam:Ion_trans_2 332 418 1.2e-13 PFAM
Pfam:Kv2channel 467 618 5.4e-48 PFAM
low complexity region 698 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148226
Predicted Effect probably damaging
Transcript: ENSMUST00000207917
AA Change: D358G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel and its activity is modulated by some other family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show reduced fasting glucose levels, hyperinsulinemia, improved glucose tolerance, altered glucose-induced electrical activity of pancreatic beta cells, and enhanced insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Kcnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Kcnb1 APN 2 167106207 missense probably damaging 1.00
IGL02945:Kcnb1 APN 2 167188388 missense probably benign 0.03
R0139:Kcnb1 UTSW 2 167105539 missense possibly damaging 0.94
R0144:Kcnb1 UTSW 2 167104547 missense probably damaging 1.00
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R0848:Kcnb1 UTSW 2 167106267 missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R3964:Kcnb1 UTSW 2 167104492 missense probably damaging 1.00
R3966:Kcnb1 UTSW 2 167104492 missense probably damaging 1.00
R4254:Kcnb1 UTSW 2 167105731 missense probably damaging 1.00
R4418:Kcnb1 UTSW 2 167105675 nonsense probably null
R4625:Kcnb1 UTSW 2 167188233 missense probably damaging 1.00
R4949:Kcnb1 UTSW 2 167105601 missense probably damaging 1.00
R5144:Kcnb1 UTSW 2 167105944 missense probably damaging 1.00
R5249:Kcnb1 UTSW 2 167105183 missense possibly damaging 0.95
R5849:Kcnb1 UTSW 2 167106026 missense probably damaging 1.00
R5869:Kcnb1 UTSW 2 167188071 missense probably benign 0.01
R6108:Kcnb1 UTSW 2 167105140 missense probably damaging 1.00
R6637:Kcnb1 UTSW 2 167105854 missense probably damaging 0.99
R6880:Kcnb1 UTSW 2 167105807 missense probably damaging 1.00
R7391:Kcnb1 UTSW 2 167105450 missense probably damaging 1.00
R7401:Kcnb1 UTSW 2 167188284 missense probably damaging 0.99
R7651:Kcnb1 UTSW 2 167188361 missense probably damaging 1.00
R7744:Kcnb1 UTSW 2 167188331 missense probably damaging 1.00
R7825:Kcnb1 UTSW 2 167105972 missense probably damaging 1.00
R7848:Kcnb1 UTSW 2 167106268 missense probably damaging 1.00
R7931:Kcnb1 UTSW 2 167106268 missense probably damaging 1.00
Z1088:Kcnb1 UTSW 2 167188061 missense probably benign 0.38
Z1176:Kcnb1 UTSW 2 167188402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCTTGTAGAACTCGGAGAAG -3'
(R):5'- TGCAGTTCCAGAATGTGCGC -3'

Sequencing Primer
(F):5'- CCTTGTAGAACTCGGAGAAGTTATTG -3'
(R):5'- GGTCCAGATCTTCCGCATCATG -3'
Posted On2018-06-22