Incidental Mutation 'R6636:Trim33'
ID525440
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Nametripartite motif-containing 33
Synonymsectodermin, Ecto, 8030451N04Rik, Tif1g
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103279293-103358775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103353719 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1061 (A1061V)
Ref Sequence ENSEMBL: ENSMUSP00000102473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860] [ENSMUST00000198706]
Predicted Effect probably damaging
Transcript: ENSMUST00000029444
AA Change: A1078V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: A1078V

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106860
AA Change: A1061V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: A1061V

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197365
Predicted Effect probably benign
Transcript: ENSMUST00000198706
SMART Domains Protein: ENSMUSP00000142585
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
Blast:BBC 1 30 9e-11 BLAST
low complexity region 111 154 N/A INTRINSIC
low complexity region 302 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103330182 missense probably benign 0.44
IGL00981:Trim33 APN 3 103351995 splice site probably benign
IGL01010:Trim33 APN 3 103346715 nonsense probably null
IGL01025:Trim33 APN 3 103353918 utr 3 prime probably benign
IGL01082:Trim33 APN 3 103326859 missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103346770 critical splice donor site probably null
IGL02291:Trim33 APN 3 103326865 missense probably damaging 1.00
IGL03248:Trim33 APN 3 103310973 unclassified probably benign
IGL03400:Trim33 APN 3 103329143 missense probably damaging 0.99
abilene UTSW 3 103321559 missense probably damaging 0.99
Bemoaned UTSW 3 103326793 missense possibly damaging 0.92
Excision UTSW 3 103344576 missense probably damaging 1.00
Peaked UTSW 3 103337532 critical splice donor site probably null
Pike UTSW 3 103310885 missense probably damaging 0.98
westworld UTSW 3 103326901 missense possibly damaging 0.46
R0143:Trim33 UTSW 3 103352101 missense probably benign 0.00
R0471:Trim33 UTSW 3 103326901 missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103310384 missense probably damaging 1.00
R0573:Trim33 UTSW 3 103351990 splice site probably benign
R0586:Trim33 UTSW 3 103310344 missense probably damaging 0.99
R1103:Trim33 UTSW 3 103310885 missense probably damaging 0.98
R1157:Trim33 UTSW 3 103353830 missense probably damaging 1.00
R1328:Trim33 UTSW 3 103353597 missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103310354 missense probably damaging 0.99
R1385:Trim33 UTSW 3 103310950 missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103310434 unclassified probably benign
R1785:Trim33 UTSW 3 103329220 frame shift probably null
R1848:Trim33 UTSW 3 103324640 unclassified probably benign
R1903:Trim33 UTSW 3 103337444 missense probably damaging 1.00
R3404:Trim33 UTSW 3 103321559 missense probably damaging 0.99
R3878:Trim33 UTSW 3 103352005 missense probably damaging 1.00
R4156:Trim33 UTSW 3 103310314 missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103329086 missense probably damaging 0.99
R4570:Trim33 UTSW 3 103330165 missense probably damaging 0.96
R4809:Trim33 UTSW 3 103329256 missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103331647 missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103341681 nonsense probably null
R5458:Trim33 UTSW 3 103330180 missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103344576 missense probably damaging 1.00
R6195:Trim33 UTSW 3 103337532 critical splice donor site probably null
R6331:Trim33 UTSW 3 103341609 missense probably benign 0.00
R6642:Trim33 UTSW 3 103337514 missense probably damaging 0.99
R6783:Trim33 UTSW 3 103352087 missense probably damaging 1.00
R6856:Trim33 UTSW 3 103352049 missense probably damaging 0.97
R7220:Trim33 UTSW 3 103326793 missense possibly damaging 0.92
R7325:Trim33 UTSW 3 103321636 missense possibly damaging 0.93
R7374:Trim33 UTSW 3 103310323 missense probably damaging 0.98
R7430:Trim33 UTSW 3 103310903 missense possibly damaging 0.92
R7438:Trim33 UTSW 3 103346640 splice site probably benign
R7491:Trim33 UTSW 3 103326148 missense probably benign 0.28
R8001:Trim33 UTSW 3 103311515 critical splice donor site probably null
R8127:Trim33 UTSW 3 103331727 missense possibly damaging 0.66
R8326:Trim33 UTSW 3 103311454 nonsense probably null
R8334:Trim33 UTSW 3 103353829 missense probably benign 0.06
RF005:Trim33 UTSW 3 103280212 frame shift probably null
RF007:Trim33 UTSW 3 103280217 small deletion probably benign
RF014:Trim33 UTSW 3 103329092 missense possibly damaging 0.94
RF061:Trim33 UTSW 3 103280217 small deletion probably benign
RF064:Trim33 UTSW 3 103280195 frame shift probably null
Z1176:Trim33 UTSW 3 103353727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTTTCGTCACCAATCCTATACAG -3'
(R):5'- CTCTCGTCTGACTTTAGGCG -3'

Sequencing Primer
(F):5'- TCACCAATCCTATACAGTCTCTTAAC -3'
(R):5'- GTCTGACTTTAGGCGTTTTCTAC -3'
Posted On2018-06-22