Incidental Mutation 'R6636:Tal1'
ID525444
Institutional Source Beutler Lab
Gene Symbol Tal1
Ensembl Gene ENSMUSG00000028717
Gene NameT cell acute lymphocytic leukemia 1
SynonymsSCL/tal-1, Hpt, bHLHa17, Scl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115056426-115071755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115068592 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 286 (N286S)
Ref Sequence ENSEMBL: ENSMUSP00000124983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030489] [ENSMUST00000161601] [ENSMUST00000162489]
Predicted Effect probably damaging
Transcript: ENSMUST00000030489
AA Change: N286S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030489
Gene: ENSMUSG00000028717
AA Change: N286S

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
low complexity region 96 110 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
HLH 193 245 2.85e-19 SMART
low complexity region 263 272 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161601
AA Change: N286S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125202
Gene: ENSMUSG00000028717
AA Change: N286S

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
low complexity region 96 110 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
HLH 193 245 2.85e-19 SMART
low complexity region 263 272 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162489
AA Change: N286S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124983
Gene: ENSMUSG00000028717
AA Change: N286S

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
low complexity region 96 110 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
HLH 193 245 2.85e-19 SMART
low complexity region 263 272 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
Meta Mutation Damage Score 0.1145 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygous targeted null mutants show retarded growth, edema, lack yolk sac hematopoiesis and die at embryonic day 9.5-10.5. Conditional mutants show loss of megakaryocyte and erhythrocyte progenitors resulting in low hematocrit and platelet count. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Tal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Tal1 APN 4 115068292 missense probably benign 0.28
IGL01614:Tal1 APN 4 115063128 critical splice acceptor site probably null
R0045:Tal1 UTSW 4 115068565 missense probably damaging 1.00
R0755:Tal1 UTSW 4 115068376 missense probably damaging 1.00
R1160:Tal1 UTSW 4 115068616 missense probably damaging 1.00
R4581:Tal1 UTSW 4 115064722 missense probably damaging 0.99
R5457:Tal1 UTSW 4 115068580 missense probably benign 0.05
R6637:Tal1 UTSW 4 115068592 missense probably damaging 0.99
R6844:Tal1 UTSW 4 115063267 missense probably benign
R7188:Tal1 UTSW 4 115068413 missense probably damaging 1.00
R7498:Tal1 UTSW 4 115068682 missense possibly damaging 0.84
R7808:Tal1 UTSW 4 115068292 missense probably benign 0.28
R8356:Tal1 UTSW 4 115063428 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCGCCTTGCCATGAAGTAC -3'
(R):5'- ACATAAGTCCATTGACCTGCTTC -3'

Sequencing Primer
(F):5'- GTACATCAATTTCCTGGCCAAG -3'
(R):5'- CAACCCAGGGGCCTAAAGG -3'
Posted On2018-06-22