Incidental Mutation 'R6603:Tas2r113'
ID525445
Institutional Source Beutler Lab
Gene Symbol Tas2r113
Ensembl Gene ENSMUSG00000056926
Gene Nametaste receptor, type 2, member 113
SynonymsT2R13, mGR13, mt2r58, Tas2r13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6603 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location132893011-132893940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132893458 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 150 (I150L)
Ref Sequence ENSEMBL: ENSMUSP00000078044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079035]
Predicted Effect probably benign
Transcript: ENSMUST00000079035
AA Change: I150L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078044
Gene: ENSMUSG00000056926
AA Change: I150L

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 9.4e-78 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,665,502 F167Y possibly damaging Het
Ap3d1 A G 10: 80,714,047 S755P probably benign Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Fbxl8 A T 8: 105,268,210 D118V probably damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lonrf1 T A 8: 36,222,941 R654S probably damaging Het
Lrrc49 A C 9: 60,593,769 probably null Het
Miip T G 4: 147,865,923 K72T possibly damaging Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tmem59l G A 8: 70,486,356 P56L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Txndc16 A G 14: 45,151,767 F492S probably damaging Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Xrcc1 C T 7: 24,571,034 Q500* probably null Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Tas2r113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Tas2r113 APN 6 132893152 missense probably benign 0.01
IGL01118:Tas2r113 APN 6 132893315 missense probably benign 0.00
IGL01366:Tas2r113 APN 6 132893797 missense probably benign 0.06
IGL01955:Tas2r113 APN 6 132893854 missense probably benign
IGL02629:Tas2r113 APN 6 132893336 missense probably damaging 1.00
IGL02681:Tas2r113 APN 6 132893367 missense probably damaging 1.00
IGL02883:Tas2r113 APN 6 132893419 missense probably damaging 1.00
R0002:Tas2r113 UTSW 6 132893779 missense probably benign 0.21
R0309:Tas2r113 UTSW 6 132893378 missense probably damaging 1.00
R1700:Tas2r113 UTSW 6 132893792 missense possibly damaging 0.92
R1748:Tas2r113 UTSW 6 132893732 missense probably damaging 0.98
R1854:Tas2r113 UTSW 6 132893329 missense probably damaging 1.00
R1974:Tas2r113 UTSW 6 132893833 missense probably benign 0.00
R4697:Tas2r113 UTSW 6 132893516 missense probably benign 0.04
R4798:Tas2r113 UTSW 6 132893707 missense possibly damaging 0.69
R4816:Tas2r113 UTSW 6 132893782 missense probably benign 0.09
R4906:Tas2r113 UTSW 6 132893558 missense possibly damaging 0.69
R6005:Tas2r113 UTSW 6 132893696 missense probably benign 0.02
R6012:Tas2r113 UTSW 6 132893681 missense probably damaging 1.00
R6107:Tas2r113 UTSW 6 132893014 missense probably damaging 1.00
R7263:Tas2r113 UTSW 6 132893576 missense possibly damaging 0.90
R7434:Tas2r113 UTSW 6 132893309 missense probably benign 0.03
R7759:Tas2r113 UTSW 6 132893927 missense possibly damaging 0.85
X0022:Tas2r113 UTSW 6 132893296 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTTCCTGGACGGTGATCAATC -3'
(R):5'- CACTGTGGTGCTGATGTCTC -3'

Sequencing Primer
(F):5'- CCTGGACGGTGATCAATCATTGTAAC -3'
(R):5'- CTTCAGATGTCTCCACAGGG -3'
Posted On2018-06-22