Incidental Mutation 'R6636:Spp1'
ID525451
Institutional Source Beutler Lab
Gene Symbol Spp1
Ensembl Gene ENSMUSG00000029304
Gene Namesecreted phosphoprotein 1
SynonymsOpn, ETA-1, OP, Spp-1, osteopontin-like protein, bone sialoprotein 1, 44kDa bone phosphoprotein, osteopontin, Apl-1, Opnl, BNSP, Ric, 2ar, minopontin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104435118-104441050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104440530 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 267 (V267A)
Ref Sequence ENSEMBL: ENSMUSP00000084043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031243] [ENSMUST00000086833] [ENSMUST00000112746] [ENSMUST00000112747] [ENSMUST00000112748] [ENSMUST00000132457] [ENSMUST00000145084]
Predicted Effect probably benign
Transcript: ENSMUST00000031243
AA Change: V266A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031243
Gene: ENSMUSG00000029304
AA Change: V266A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 294 2.5e-157 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086833
AA Change: V267A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084043
Gene: ENSMUSG00000029304
AA Change: V267A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 295 2.21e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112746
SMART Domains Protein: ENSMUSP00000108366
Gene: ENSMUSG00000029304

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Osteopontin 20 164 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112747
AA Change: V266A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108367
Gene: ENSMUSG00000029304
AA Change: V266A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 294 2.5e-157 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112748
AA Change: V266A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108368
Gene: ENSMUSG00000029304
AA Change: V266A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 294 2.5e-157 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132457
Predicted Effect probably benign
Transcript: ENSMUST00000145084
SMART Domains Protein: ENSMUSP00000117338
Gene: ENSMUSG00000029304

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Osteopontin 20 152 1.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199139
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Two alleles determine natural resistance/susceptibility to the lethal effects of the Gilliam strain of Rickettsia tsutsugamushi. Mice homozygous for a knock-out allele exhibit abnormal osteoclast physiology, macrophage recruitment, wound healing, response to injury, and inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Spp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4755:Spp1 UTSW 5 104435215 intron probably benign
R4969:Spp1 UTSW 5 104440287 missense possibly damaging 0.68
R5531:Spp1 UTSW 5 104440558 missense probably benign 0.12
R6198:Spp1 UTSW 5 104439508 unclassified probably null
R6291:Spp1 UTSW 5 104439376 missense possibly damaging 0.89
R7029:Spp1 UTSW 5 104439301 missense probably benign 0.02
R7228:Spp1 UTSW 5 104440445 missense probably damaging 0.99
R7695:Spp1 UTSW 5 104435143 start gained probably benign
R7793:Spp1 UTSW 5 104440334 missense probably damaging 1.00
R8050:Spp1 UTSW 5 104440414 missense probably benign 0.00
X0011:Spp1 UTSW 5 104440422 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGCCCTCTGATCAGGACAAC -3'
(R):5'- ATCCACTGAACTGAGAAATGAGCAG -3'

Sequencing Primer
(F):5'- TCTGATCAGGACAACAACGG -3'
(R):5'- GAGCAGTTAGTATTCCTGCTTAACC -3'
Posted On2018-06-22