Incidental Mutation 'R6603:Adam18'
ID 525458
Institutional Source Beutler Lab
Gene Symbol Adam18
Ensembl Gene ENSMUSG00000031552
Gene Name a disintegrin and metallopeptidase domain 18
Synonyms Dtgn3, Adam27
MMRRC Submission 044726-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6603 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 25092262-25164771 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25155518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 167 (F167Y)
Ref Sequence ENSEMBL: ENSMUSP00000033957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033957] [ENSMUST00000173833]
AlphaFold Q9R157
Predicted Effect possibly damaging
Transcript: ENSMUST00000033957
AA Change: F167Y

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033957
Gene: ENSMUSG00000031552
AA Change: F167Y

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 1.7e-25 PFAM
Pfam:Reprolysin 180 377 1.1e-57 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173833
AA Change: F167Y

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133378
Gene: ENSMUSG00000031552
AA Change: F167Y

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 9.5e-35 PFAM
Pfam:Reprolysin 180 378 7.7e-56 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during early stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with that of controls. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3d1 A G 10: 80,549,881 (GRCm39) S755P probably benign Het
Aph1a A T 3: 95,802,808 (GRCm39) N136I probably damaging Het
AU040320 T A 4: 126,686,046 (GRCm39) N207K probably benign Het
Caprin1 A T 2: 103,605,856 (GRCm39) D377E probably benign Het
Col18a1 A G 10: 76,899,811 (GRCm39) probably null Het
Ddi2 T C 4: 141,411,181 (GRCm39) N577S probably damaging Het
Dip2c T A 13: 9,704,624 (GRCm39) probably null Het
Dmbt1 A T 7: 130,648,240 (GRCm39) probably null Het
Fam13a T C 6: 58,964,174 (GRCm39) K86R probably benign Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Fbxl8 A T 8: 105,994,842 (GRCm39) D118V probably damaging Het
Garin5b G A 7: 4,761,431 (GRCm39) P427L possibly damaging Het
Git2 C A 5: 114,869,052 (GRCm39) probably null Het
Gm17190 T G 13: 96,218,770 (GRCm39) D35E possibly damaging Het
Gnb4 C T 3: 32,639,295 (GRCm39) D333N probably damaging Het
Has2 T A 15: 56,531,968 (GRCm39) D249V probably damaging Het
Ighv1-23 A G 12: 114,728,141 (GRCm39) S94P probably damaging Het
Itpr2 A G 6: 146,248,669 (GRCm39) I1029T probably damaging Het
Kctd16 T C 18: 40,391,544 (GRCm39) I44T probably benign Het
Kpna1 A G 16: 35,849,890 (GRCm39) probably null Het
Lonrf1 T A 8: 36,690,095 (GRCm39) R654S probably damaging Het
Lrrc49 A C 9: 60,501,052 (GRCm39) probably null Het
Miip T G 4: 147,950,380 (GRCm39) K72T possibly damaging Het
Mink1 C T 11: 70,500,419 (GRCm39) P782S probably damaging Het
Mpped2 A G 2: 106,697,322 (GRCm39) T266A probably benign Het
Naip1 G A 13: 100,559,578 (GRCm39) S1142F probably benign Het
Naip1 C T 13: 100,559,666 (GRCm39) G1113S probably benign Het
Nbr1 A G 11: 101,446,931 (GRCm39) probably benign Het
Necab3 A T 2: 154,396,842 (GRCm39) N46K probably damaging Het
Or51a8 A T 7: 102,549,621 (GRCm39) I16F probably benign Het
Phtf1 C T 3: 103,901,189 (GRCm39) R360C probably damaging Het
Plcl2 A G 17: 50,914,145 (GRCm39) I385V probably benign Het
Prmt8 A T 6: 127,706,376 (GRCm39) F138L probably benign Het
Prpf40a T G 2: 53,042,975 (GRCm39) R436S probably damaging Het
Rab27b T A 18: 70,118,375 (GRCm39) I181F probably damaging Het
Rasgrf1 A G 9: 89,792,310 (GRCm39) E87G probably damaging Het
Scrib T A 15: 75,934,572 (GRCm39) T674S probably benign Het
Slc9a4 A G 1: 40,662,664 (GRCm39) S644G probably benign Het
Slc9a9 G A 9: 94,821,599 (GRCm39) A329T probably damaging Het
Smc4 T C 3: 68,929,794 (GRCm39) probably null Het
Sox7 T A 14: 64,185,637 (GRCm39) H224Q probably benign Het
Spata31 T C 13: 65,070,479 (GRCm39) S876P probably damaging Het
Syndig1 G A 2: 149,845,208 (GRCm39) V244M probably damaging Het
Tas2r113 A T 6: 132,870,421 (GRCm39) I150L probably benign Het
Tasor A G 14: 27,168,343 (GRCm39) Y295C probably damaging Het
Tmem59l G A 8: 70,939,006 (GRCm39) P56L probably benign Het
Tnfrsf8 A T 4: 145,019,168 (GRCm39) D222E possibly damaging Het
Trim52 T C 14: 106,344,483 (GRCm39) L47P probably damaging Het
Ttc34 T A 4: 154,923,762 (GRCm39) I157K probably benign Het
Txndc16 A G 14: 45,389,224 (GRCm39) F492S probably damaging Het
Ubr4 A G 4: 139,182,897 (GRCm39) I428V probably benign Het
Vmn2r41 T A 7: 8,141,359 (GRCm39) I702F probably damaging Het
Wdr12 T A 1: 60,121,783 (GRCm39) H256L probably damaging Het
Xirp2 A G 2: 67,346,888 (GRCm39) H3043R probably benign Het
Xrcc1 C T 7: 24,270,459 (GRCm39) Q500* probably null Het
Zfp583 T C 7: 6,328,475 (GRCm39) N38S probably damaging Het
Other mutations in Adam18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Adam18 APN 8 25,118,149 (GRCm39) missense probably damaging 1.00
IGL01649:Adam18 APN 8 25,104,912 (GRCm39) missense possibly damaging 0.82
IGL02212:Adam18 APN 8 25,127,195 (GRCm39) missense probably benign 0.02
IGL02455:Adam18 APN 8 25,141,864 (GRCm39) missense probably damaging 0.96
IGL02525:Adam18 APN 8 25,131,783 (GRCm39) splice site probably benign
IGL02525:Adam18 APN 8 25,101,060 (GRCm39) missense probably benign 0.00
IGL02966:Adam18 APN 8 25,101,165 (GRCm39) splice site probably benign
IGL03136:Adam18 APN 8 25,131,852 (GRCm39) missense probably damaging 1.00
G5030:Adam18 UTSW 8 25,141,872 (GRCm39) missense probably benign 0.24
R0135:Adam18 UTSW 8 25,155,558 (GRCm39) missense possibly damaging 0.71
R0280:Adam18 UTSW 8 25,164,070 (GRCm39) missense probably benign 0.06
R0389:Adam18 UTSW 8 25,119,653 (GRCm39) splice site probably null
R0390:Adam18 UTSW 8 25,164,070 (GRCm39) missense probably benign 0.06
R0443:Adam18 UTSW 8 25,119,653 (GRCm39) splice site probably null
R0479:Adam18 UTSW 8 25,141,838 (GRCm39) missense probably benign
R0578:Adam18 UTSW 8 25,131,863 (GRCm39) missense possibly damaging 0.82
R0645:Adam18 UTSW 8 25,162,136 (GRCm39) nonsense probably null
R0881:Adam18 UTSW 8 25,162,159 (GRCm39) splice site probably benign
R0885:Adam18 UTSW 8 25,141,802 (GRCm39) missense probably damaging 1.00
R0973:Adam18 UTSW 8 25,137,869 (GRCm39) missense probably benign 0.01
R0973:Adam18 UTSW 8 25,137,869 (GRCm39) missense probably benign 0.01
R0974:Adam18 UTSW 8 25,137,869 (GRCm39) missense probably benign 0.01
R1005:Adam18 UTSW 8 25,155,530 (GRCm39) missense probably benign 0.05
R1356:Adam18 UTSW 8 25,158,611 (GRCm39) splice site probably benign
R1510:Adam18 UTSW 8 25,115,847 (GRCm39) missense probably benign 0.01
R1552:Adam18 UTSW 8 25,136,377 (GRCm39) missense probably benign
R1568:Adam18 UTSW 8 25,137,799 (GRCm39) splice site probably null
R1639:Adam18 UTSW 8 25,142,168 (GRCm39) missense probably benign 0.00
R1968:Adam18 UTSW 8 25,136,463 (GRCm39) missense probably benign 0.32
R2029:Adam18 UTSW 8 25,140,893 (GRCm39) missense probably damaging 1.00
R2058:Adam18 UTSW 8 25,162,082 (GRCm39) splice site probably benign
R2211:Adam18 UTSW 8 25,118,171 (GRCm39) missense probably damaging 0.96
R2237:Adam18 UTSW 8 25,136,303 (GRCm39) missense probably benign 0.01
R2238:Adam18 UTSW 8 25,136,303 (GRCm39) missense probably benign 0.01
R2239:Adam18 UTSW 8 25,136,303 (GRCm39) missense probably benign 0.01
R2518:Adam18 UTSW 8 25,127,157 (GRCm39) missense probably damaging 1.00
R3122:Adam18 UTSW 8 25,118,248 (GRCm39) missense possibly damaging 0.74
R3426:Adam18 UTSW 8 25,157,620 (GRCm39) missense probably damaging 1.00
R3428:Adam18 UTSW 8 25,157,620 (GRCm39) missense probably damaging 1.00
R3967:Adam18 UTSW 8 25,119,726 (GRCm39) missense probably benign 0.12
R4833:Adam18 UTSW 8 25,164,117 (GRCm39) missense probably benign 0.01
R4965:Adam18 UTSW 8 25,131,827 (GRCm39) missense probably damaging 1.00
R5249:Adam18 UTSW 8 25,115,868 (GRCm39) missense probably benign 0.00
R5534:Adam18 UTSW 8 25,155,530 (GRCm39) missense probably benign 0.05
R5920:Adam18 UTSW 8 25,164,091 (GRCm39) missense probably damaging 1.00
R6329:Adam18 UTSW 8 25,104,843 (GRCm39) missense probably damaging 1.00
R6450:Adam18 UTSW 8 25,119,691 (GRCm39) missense probably benign 0.05
R6479:Adam18 UTSW 8 25,119,681 (GRCm39) missense probably benign 0.29
R6516:Adam18 UTSW 8 25,164,703 (GRCm39) missense probably damaging 1.00
R7194:Adam18 UTSW 8 25,141,868 (GRCm39) missense possibly damaging 0.67
R7226:Adam18 UTSW 8 25,137,824 (GRCm39) missense probably damaging 1.00
R7266:Adam18 UTSW 8 25,157,639 (GRCm39) missense probably benign 0.00
R7397:Adam18 UTSW 8 25,136,321 (GRCm39) missense possibly damaging 0.48
R7575:Adam18 UTSW 8 25,115,873 (GRCm39) missense possibly damaging 0.50
R7786:Adam18 UTSW 8 25,101,134 (GRCm39) missense probably benign 0.00
R7872:Adam18 UTSW 8 25,101,116 (GRCm39) missense probably benign 0.00
R8069:Adam18 UTSW 8 25,118,246 (GRCm39) missense possibly damaging 0.96
R8411:Adam18 UTSW 8 25,142,143 (GRCm39) missense probably damaging 1.00
R8713:Adam18 UTSW 8 25,142,189 (GRCm39) missense probably benign 0.22
R8785:Adam18 UTSW 8 25,140,911 (GRCm39) missense probably damaging 0.97
R8803:Adam18 UTSW 8 25,137,878 (GRCm39) missense probably benign 0.02
R8882:Adam18 UTSW 8 25,136,438 (GRCm39) missense probably benign 0.25
R8944:Adam18 UTSW 8 25,164,703 (GRCm39) missense probably damaging 1.00
R9000:Adam18 UTSW 8 25,127,162 (GRCm39) missense probably benign 0.27
R9184:Adam18 UTSW 8 25,137,847 (GRCm39) missense probably benign 0.22
R9258:Adam18 UTSW 8 25,158,574 (GRCm39) missense probably benign 0.05
R9306:Adam18 UTSW 8 25,136,420 (GRCm39) missense possibly damaging 0.74
R9377:Adam18 UTSW 8 25,104,859 (GRCm39) nonsense probably null
R9472:Adam18 UTSW 8 25,127,248 (GRCm39) missense probably benign 0.04
R9476:Adam18 UTSW 8 25,115,807 (GRCm39) missense probably benign 0.18
R9508:Adam18 UTSW 8 25,143,778 (GRCm39) missense possibly damaging 0.88
R9567:Adam18 UTSW 8 25,118,210 (GRCm39) missense probably benign 0.25
R9603:Adam18 UTSW 8 25,118,147 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGCTAATCTTCCTGCATTGTTTAATGG -3'
(R):5'- GCCTTTCTACATTTAGGGGATTCC -3'

Sequencing Primer
(F):5'- ATGGTTTCCAATAACAAATGTTTCC -3'
(R):5'- TCCTGCAGTTGGAAAATGTCAGC -3'
Posted On 2018-06-22