Mutagenetix > Incidental Mutation

Incidental Mutation 'R6636:C3ar1'

525459

Institutional Source

Beutler Lab

Gene Symbol

C3ar1

Ensembl Gene

ENSMUSG00000040552

Gene Name

complement component 3a receptor 1

Synonyms

C3aR, anaphylatoxin C3a receptor

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6636 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122847138-122856161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122851054 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 68 (D68G)

Ref Sequence

ENSEMBL: ENSMUSP00000048092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042081]

AlphaFold

O09047

Predicted Effect

probably damaging
Transcript: ENSMUST00000042081
AA Change: D68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552
AA Change: D68G

Domain	Start	End	E-Value	Type
Pfam:7tm_1	40	193	8.1e-25	PFAM
Pfam:7TM_GPCR_Srsx	281	443	7.8e-8	PFAM
Pfam:7tm_1	313	428	6.5e-17	PFAM

Meta Mutation Damage Score

0.9042

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.8%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous targeted mutants display protective effects against the changes in lung physiology after allergen challenge, increased lethality to endotoxin shock, and elevated IL1B following LPS challenge, supporting the role of C3arin proinflammatory responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	A	G	15: 64,787,402	V513A	probably damaging	Het
Adgrl4	G	A	3: 151,517,773	W621*	probably null	Het
Ap4m1	A	G	5: 138,172,175		probably benign	Het
Atp6v1b2	T	C	8: 69,101,374	Y68H	probably damaging	Het
AY761185	T	A	8: 20,944,540		probably null	Het
Cdh10	A	T	15: 18,985,173	I308F	probably damaging	Het
Coq8a	A	T	1: 180,178,987	S112T	probably benign	Het
Diexf	A	T	1: 193,113,767	F197I	probably damaging	Het
Dmgdh	A	T	13: 93,709,198	E453D	probably benign	Het
Fryl	C	A	5: 73,133,312	R83L	probably benign	Het
Gm4861	C	T	3: 137,550,999		probably null	Het
Gnai1	T	C	5: 18,273,474	D231G	probably damaging	Het
Hfe	C	G	13: 23,706,795	E120D	possibly damaging	Het
Hfe	T	C	13: 23,706,796	E120G	possibly damaging	Het
Hgd	A	G	16: 37,615,374	N149S	possibly damaging	Het
Kcnb1	T	C	2: 167,105,854	D358G	probably damaging	Het
Lama2	C	A	10: 27,124,568	V1653L	probably benign	Het
Lamc1	A	T	1: 153,241,975	I947N	possibly damaging	Het
Lamp3	A	G	16: 19,701,233	F67L	probably benign	Het
Ltbp2	T	C	12: 84,875,838	I132V	probably benign	Het
Muc4	C	T	16: 32,753,964	P1280L	probably benign	Het
Muc5ac	T	C	7: 141,818,605	Y2659H	possibly damaging	Het
Nmbr	T	C	10: 14,770,234	S168P	probably benign	Het
Nsl1	A	G	1: 191,075,127	T168A	probably benign	Het
Olfr1197	T	C	2: 88,728,841	I253V	probably benign	Het
Olfr130	G	A	17: 38,067,224	D18N	probably damaging	Het
Olfr1467	T	C	19: 13,365,225	V199A	probably benign	Het
Olfr284	A	G	15: 98,340,950	F13S	probably benign	Het
Pde1c	A	C	6: 56,180,102	V191G	probably damaging	Het
Proc	T	A	18: 32,123,760	I285F	probably benign	Het
R3hdm1	GAA	GAAA	1: 128,162,811		probably null	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Spa17	A	T	9: 37,611,974	S6T	probably benign	Het
Spp1	T	C	5: 104,440,530	V267A	possibly damaging	Het
Stk17b	A	T	1: 53,761,088	Y244N	probably damaging	Het
Tal1	A	G	4: 115,068,592	N286S	probably damaging	Het
Tgm7	T	A	2: 121,101,090	R197S	probably damaging	Het
Tmcc3	T	A	10: 94,578,424	V27E	probably benign	Het
Topaz1	A	T	9: 122,749,786	Q587L	probably benign	Het
Trim33	C	T	3: 103,353,719	A1061V	probably damaging	Het
Ttll1	C	G	15: 83,499,946	W160S	probably damaging	Het
Wnt7a	A	G	6: 91,394,558	Y141H	probably benign	Het

Other mutations in C3ar1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01818:C3ar1	APN	6	122850419	missense	probably benign	0.00
IGL01936:C3ar1	APN	6	122851235	missense	probably benign	0.04
IGL01998:C3ar1	APN	6	122850940	missense	probably damaging	1.00
IGL02351:C3ar1	APN	6	122849975	missense	probably damaging	1.00
IGL02358:C3ar1	APN	6	122849975	missense	probably damaging	1.00
IGL02399:C3ar1	APN	6	122849879	missense	probably benign	0.00
PIT4618001:C3ar1	UTSW	6	122850787	missense	probably benign	0.25
R0014:C3ar1	UTSW	6	122850851	missense	probably damaging	1.00
R0195:C3ar1	UTSW	6	122851155	missense	possibly damaging	0.95
R0257:C3ar1	UTSW	6	122850787	missense	probably benign	0.25
R0344:C3ar1	UTSW	6	122850772	missense	probably benign	0.45
R4345:C3ar1	UTSW	6	122850700	missense	probably damaging	1.00
R4614:C3ar1	UTSW	6	122850721	missense	probably benign	0.00
R4643:C3ar1	UTSW	6	122850974	missense	probably damaging	1.00
R4840:C3ar1	UTSW	6	122850764	missense	probably benign
R5235:C3ar1	UTSW	6	122850922	missense	probably damaging	1.00
R5303:C3ar1	UTSW	6	122849835	missense	probably damaging	1.00
R5610:C3ar1	UTSW	6	122850578	missense	probably benign	0.01
R5762:C3ar1	UTSW	6	122850362	missense	probably benign	0.07
R5873:C3ar1	UTSW	6	122850422	missense	probably benign	0.24
R5877:C3ar1	UTSW	6	122850622	missense	probably benign	0.17
R6327:C3ar1	UTSW	6	122850146	missense	probably damaging	1.00
R6440:C3ar1	UTSW	6	122850508	missense	probably damaging	0.99
R6505:C3ar1	UTSW	6	122850640	missense	probably benign	0.03
R6755:C3ar1	UTSW	6	122849858	missense	probably benign	0.00
R6953:C3ar1	UTSW	6	122850632	missense	possibly damaging	0.49
R7985:C3ar1	UTSW	6	122850005	missense	probably damaging	1.00
R8049:C3ar1	UTSW	6	122850100	missense	probably damaging	0.97
R8936:C3ar1	UTSW	6	122851085	missense	probably damaging	0.97
R9337:C3ar1	UTSW	6	122850319	missense	probably benign	0.00
X0065:C3ar1	UTSW	6	122850765	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTCGATGATTCTGGCACCAG -3'
(R):5'- GGAGTCTTTCGATGCTGACAC -3'

Sequencing Primer
(F):5'- GCACCAGATTGGCTTATGTAC -3'
(R):5'- TTCGATGCTGACACCAATTCAACTG -3'

Posted On

2018-06-22