Incidental Mutation 'R6603:Lonrf1'
ID525461
Institutional Source Beutler Lab
Gene Symbol Lonrf1
Ensembl Gene ENSMUSG00000039633
Gene NameLON peptidase N-terminal domain and ring finger 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R6603 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location36216064-36249516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36222941 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 654 (R654S)
Ref Sequence ENSEMBL: ENSMUSP00000066403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065297]
Predicted Effect probably damaging
Transcript: ENSMUST00000065297
AA Change: R654S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066403
Gene: ENSMUSG00000039633
AA Change: R654S

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 161 N/A INTRINSIC
RING 193 228 1.57e-2 SMART
SCOP:d1elwa_ 274 387 3e-16 SMART
Blast:TPR 309 342 1e-14 BLAST
Blast:TPR 343 376 2e-15 BLAST
low complexity region 454 464 N/A INTRINSIC
RING 543 580 3.12e-6 SMART
Pfam:LON_substr_bdg 631 830 8e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,665,502 F167Y possibly damaging Het
Ap3d1 A G 10: 80,714,047 S755P probably benign Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Fbxl8 A T 8: 105,268,210 D118V probably damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lrrc49 A C 9: 60,593,769 probably null Het
Miip T G 4: 147,865,923 K72T possibly damaging Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tas2r113 A T 6: 132,893,458 I150L probably benign Het
Tmem59l G A 8: 70,486,356 P56L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Txndc16 A G 14: 45,151,767 F492S probably damaging Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Xrcc1 C T 7: 24,571,034 Q500* probably null Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Lonrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lonrf1 APN 8 36230077 splice site probably benign
IGL02195:Lonrf1 APN 8 36219948 nonsense probably null
IGL03087:Lonrf1 APN 8 36225551 splice site probably null
IGL03163:Lonrf1 APN 8 36230330 missense probably benign 0.03
IGL03225:Lonrf1 APN 8 36222701 missense probably damaging 0.96
BB009:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
BB019:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
R0480:Lonrf1 UTSW 8 36222710 missense probably damaging 1.00
R0504:Lonrf1 UTSW 8 36231159 missense possibly damaging 0.93
R0557:Lonrf1 UTSW 8 36230420 missense probably benign 0.12
R1489:Lonrf1 UTSW 8 36222954 missense probably damaging 1.00
R1572:Lonrf1 UTSW 8 36233972 missense probably benign 0.02
R2225:Lonrf1 UTSW 8 36236098 missense probably damaging 0.98
R2345:Lonrf1 UTSW 8 36222862 critical splice donor site probably null
R4821:Lonrf1 UTSW 8 36219972 missense probably benign
R4934:Lonrf1 UTSW 8 36233949 missense probably damaging 1.00
R5538:Lonrf1 UTSW 8 36223024 critical splice acceptor site probably null
R6124:Lonrf1 UTSW 8 36229200 missense probably damaging 0.97
R6485:Lonrf1 UTSW 8 36229134 critical splice donor site probably null
R6886:Lonrf1 UTSW 8 36229037 splice site probably null
R7113:Lonrf1 UTSW 8 36230510 missense probably benign 0.01
R7689:Lonrf1 UTSW 8 36248764 nonsense probably null
R7711:Lonrf1 UTSW 8 36249221 missense probably damaging 1.00
R7743:Lonrf1 UTSW 8 36249052 missense possibly damaging 0.72
R7932:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
R8085:Lonrf1 UTSW 8 36248615 missense probably damaging 1.00
R8183:Lonrf1 UTSW 8 36222665 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AATGCACGTTTCGGATTTGTAGC -3'
(R):5'- AAACACATTTCGTCCTTGTTGC -3'

Sequencing Primer
(F):5'- TTGTAGCATACAACCATAATCTGC -3'
(R):5'- ACATTTCGTCCTTGTTGCTATTATTG -3'
Posted On2018-06-22