Incidental Mutation 'R6603:Tmem59l'
ID525463
Institutional Source Beutler Lab
Gene Symbol Tmem59l
Ensembl Gene ENSMUSG00000035964
Gene Nametransmembrane protein 59-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6603 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70483867-70487358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70486356 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 56 (P56L)
Ref Sequence ENSEMBL: ENSMUSP00000043659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045286]
Predicted Effect probably benign
Transcript: ENSMUST00000045286
AA Change: P56L

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043659
Gene: ENSMUSG00000035964
AA Change: P56L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 44 60 N/A INTRINSIC
Pfam:BSMAP 72 278 1e-67 PFAM
low complexity region 311 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211264
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted type-I membrane glycoprotein. The encoded protein may play a role in functioning of the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,665,502 F167Y possibly damaging Het
Ap3d1 A G 10: 80,714,047 S755P probably benign Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Fbxl8 A T 8: 105,268,210 D118V probably damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lonrf1 T A 8: 36,222,941 R654S probably damaging Het
Lrrc49 A C 9: 60,593,769 probably null Het
Miip T G 4: 147,865,923 K72T possibly damaging Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tas2r113 A T 6: 132,893,458 I150L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Txndc16 A G 14: 45,151,767 F492S probably damaging Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Xrcc1 C T 7: 24,571,034 Q500* probably null Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Tmem59l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Tmem59l APN 8 70485665 splice site probably benign
IGL01479:Tmem59l APN 8 70486098 missense probably benign 0.00
IGL01783:Tmem59l APN 8 70487224 missense probably damaging 1.00
IGL01998:Tmem59l APN 8 70484781 missense probably benign 0.16
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0974:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R1201:Tmem59l UTSW 8 70484387 nonsense probably null
R1540:Tmem59l UTSW 8 70485154 missense probably benign 0.05
R1775:Tmem59l UTSW 8 70486253 missense probably damaging 1.00
R2217:Tmem59l UTSW 8 70487301 missense unknown
R2238:Tmem59l UTSW 8 70485122 missense probably damaging 0.99
R2313:Tmem59l UTSW 8 70487301 missense unknown
R2315:Tmem59l UTSW 8 70487301 missense unknown
R2969:Tmem59l UTSW 8 70487301 missense unknown
R2970:Tmem59l UTSW 8 70487301 missense unknown
R3011:Tmem59l UTSW 8 70486237 missense probably damaging 1.00
R3725:Tmem59l UTSW 8 70487301 missense unknown
R3726:Tmem59l UTSW 8 70487301 missense unknown
R3774:Tmem59l UTSW 8 70487301 missense unknown
R3775:Tmem59l UTSW 8 70487301 missense unknown
R3826:Tmem59l UTSW 8 70487301 missense unknown
R3827:Tmem59l UTSW 8 70487301 missense unknown
R3828:Tmem59l UTSW 8 70487301 missense unknown
R3829:Tmem59l UTSW 8 70487301 missense unknown
R3851:Tmem59l UTSW 8 70487301 missense unknown
R3943:Tmem59l UTSW 8 70487301 missense unknown
R3944:Tmem59l UTSW 8 70487301 missense unknown
R4064:Tmem59l UTSW 8 70485719 missense probably damaging 1.00
R4409:Tmem59l UTSW 8 70487301 missense unknown
R4410:Tmem59l UTSW 8 70487301 missense unknown
R4422:Tmem59l UTSW 8 70486099 missense probably damaging 0.98
R4470:Tmem59l UTSW 8 70487301 missense unknown
R4471:Tmem59l UTSW 8 70487301 missense unknown
R4767:Tmem59l UTSW 8 70486098 missense probably benign 0.00
R5321:Tmem59l UTSW 8 70487215 missense probably damaging 1.00
R6130:Tmem59l UTSW 8 70484605 missense probably damaging 1.00
R6527:Tmem59l UTSW 8 70486125 missense probably damaging 1.00
R6750:Tmem59l UTSW 8 70486372 missense probably benign 0.34
R7542:Tmem59l UTSW 8 70485164 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GTAAGCTTCTGTGCAGGCTG -3'
(R):5'- CACTATCCAGCCTGCTTAGAAAG -3'

Sequencing Primer
(F):5'- AGTCACTGGGAGCTGCTTC -3'
(R):5'- GCTGCTTGCTGTTTCTCAGAAG -3'
Posted On2018-06-22