Incidental Mutation 'R6636:Atp6v1b2'
ID525464
Institutional Source Beutler Lab
Gene Symbol Atp6v1b2
Ensembl Gene ENSMUSG00000006273
Gene NameATPase, H+ transporting, lysosomal V1 subunit B2
SynonymsAtp6b2, HO57
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location69088646-69113711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69101374 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 68 (Y68H)
Ref Sequence ENSEMBL: ENSMUSP00000006435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006435]
Predicted Effect probably damaging
Transcript: ENSMUST00000006435
AA Change: Y68H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006435
Gene: ENSMUSG00000006273
AA Change: Y68H

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 50 116 3.2e-14 PFAM
Pfam:ATP-synt_ab 173 399 1.9e-69 PFAM
Pfam:ATP-synt_ab_C 416 510 5.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153680
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. The protein encoded by this gene is one of two V1 domain B subunit isoforms and is the only B isoform highly expressed in osteoclasts. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Atp6v1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp6v1b2 APN 8 69088934 splice site probably null
IGL00908:Atp6v1b2 APN 8 69096266 missense probably benign 0.00
IGL01914:Atp6v1b2 APN 8 69096280 splice site probably benign
IGL03010:Atp6v1b2 APN 8 69105882 missense probably damaging 0.97
IGL03376:Atp6v1b2 APN 8 69102159 splice site probably benign
R0127:Atp6v1b2 UTSW 8 69103460 missense probably damaging 1.00
R0427:Atp6v1b2 UTSW 8 69101432 missense probably damaging 1.00
R0523:Atp6v1b2 UTSW 8 69109985 missense possibly damaging 0.52
R1754:Atp6v1b2 UTSW 8 69101961 missense probably benign 0.25
R1932:Atp6v1b2 UTSW 8 69102807 nonsense probably null
R1954:Atp6v1b2 UTSW 8 69105903 missense possibly damaging 0.95
R2228:Atp6v1b2 UTSW 8 69102759 splice site probably null
R2229:Atp6v1b2 UTSW 8 69102759 splice site probably null
R4448:Atp6v1b2 UTSW 8 69102022 missense probably benign
R4738:Atp6v1b2 UTSW 8 69103410 missense probably benign
R5243:Atp6v1b2 UTSW 8 69103739 missense probably benign 0.07
R5388:Atp6v1b2 UTSW 8 69101437 missense probably benign 0.00
R5664:Atp6v1b2 UTSW 8 69107620 missense probably damaging 0.99
R5774:Atp6v1b2 UTSW 8 69101961 missense probably damaging 0.97
R5894:Atp6v1b2 UTSW 8 69107566 intron probably null
R6015:Atp6v1b2 UTSW 8 69102496 missense probably damaging 1.00
R6147:Atp6v1b2 UTSW 8 69102482 nonsense probably null
R6217:Atp6v1b2 UTSW 8 69109878 critical splice acceptor site probably null
R6637:Atp6v1b2 UTSW 8 69101374 missense probably damaging 1.00
R7032:Atp6v1b2 UTSW 8 69088896 missense probably benign 0.44
R7108:Atp6v1b2 UTSW 8 69102501 missense probably damaging 1.00
R7184:Atp6v1b2 UTSW 8 69102567 missense possibly damaging 0.55
R7578:Atp6v1b2 UTSW 8 69103476 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTACCTTGCACTAGTTTGCCAC -3'
(R):5'- CTGAGTTAGGTACCATTTTGATGGC -3'

Sequencing Primer
(F):5'- ACTAGTTTGCCACTTTGTACACTAG -3'
(R):5'- ATCCGATCGCCAGTGAATG -3'
Posted On2018-06-22