Incidental Mutation 'R6636:Spa17'
ID525467
Institutional Source Beutler Lab
Gene Symbol Spa17
Ensembl Gene ENSMUSG00000001948
Gene Namesperm autoantigenic protein 17
SynonymsSp17, band 34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37603290-37613722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37611974 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 6 (S6T)
Ref Sequence ENSEMBL: ENSMUSP00000002013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002013] [ENSMUST00000213126] [ENSMUST00000214786] [ENSMUST00000215474] [ENSMUST00000215829]
Predicted Effect probably benign
Transcript: ENSMUST00000002013
AA Change: S6T

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002013
Gene: ENSMUSG00000001948
AA Change: S6T

DomainStartEndE-ValueType
RIIa 14 51 7.04e-15 SMART
low complexity region 75 86 N/A INTRINSIC
IQ 111 133 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213126
Predicted Effect probably benign
Transcript: ENSMUST00000214786
AA Change: S6T

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215336
Predicted Effect probably benign
Transcript: ENSMUST00000215474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215678
Predicted Effect probably benign
Transcript: ENSMUST00000215829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217567
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein present at the cell surface. The N-terminus has sequence similarity to human cAMP-dependent protein kinase A (PKA) type II alpha regulatory subunit (RIIa) while the C-terminus has an IQ calmodulin-binding motif. The central portion of the protein has carbohydrate binding motifs and likely functions in cell-cell adhesion. The protein was initially characterized by its involvement in the binding of sperm to the zona pellucida of the oocyte. Recent studies indicate that it is also involved in additional cell-cell adhesion functions such as immune cell migration and metastasis. A retrotransposed pseudogene is present on chromosome 10q22.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Spa17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0575:Spa17 UTSW 9 37603393 missense probably damaging 0.99
R3789:Spa17 UTSW 9 37611845 missense possibly damaging 0.89
R5244:Spa17 UTSW 9 37611989 start codon destroyed probably damaging 1.00
R5503:Spa17 UTSW 9 37611977 missense probably damaging 1.00
R6612:Spa17 UTSW 9 37605794 missense probably benign 0.14
R6637:Spa17 UTSW 9 37611974 missense probably benign 0.45
R7233:Spa17 UTSW 9 37603291 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAGGCTGAAGACATGTATATTCC -3'
(R):5'- GAGCACCAGGACCTAGATTGTG -3'

Sequencing Primer
(F):5'- GCTGAAGACATGTATATTCCTCAATC -3'
(R):5'- GAGAAATGATTTGAGTCGTGA -3'
Posted On2018-06-22