Incidental Mutation 'R6636:Topaz1'
ID525469
Institutional Source Beutler Lab
Gene Symbol Topaz1
Ensembl Gene ENSMUSG00000094985
Gene Nametestis and ovary specific PAZ domain containing 1
SynonymsGm9524
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location122747346-122802135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122749786 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 587 (Q587L)
Ref Sequence ENSEMBL: ENSMUSP00000136304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178679]
Predicted Effect probably benign
Transcript: ENSMUST00000178679
AA Change: Q587L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136304
Gene: ENSMUSG00000094985
AA Change: Q587L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
low complexity region 236 251 N/A INTRINSIC
low complexity region 531 545 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
low complexity region 1129 1139 N/A INTRINSIC
Pfam:Asp_Glu_race_2 1189 1422 3.6e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213519
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with abnormal meiosis and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Topaz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0083:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0108:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0220:Topaz1 UTSW 9 122749303 missense possibly damaging 0.53
R0519:Topaz1 UTSW 9 122749479 missense possibly damaging 0.53
R0617:Topaz1 UTSW 9 122749906 missense possibly damaging 0.73
R0637:Topaz1 UTSW 9 122791477 nonsense probably null
R0637:Topaz1 UTSW 9 122797662 missense probably benign
R1368:Topaz1 UTSW 9 122748250 missense possibly damaging 0.72
R1519:Topaz1 UTSW 9 122767011 missense probably benign 0.33
R1526:Topaz1 UTSW 9 122796043 missense probably damaging 0.98
R1634:Topaz1 UTSW 9 122780675 splice site probably benign
R1871:Topaz1 UTSW 9 122799479 missense probably benign 0.18
R1879:Topaz1 UTSW 9 122749619 missense possibly damaging 0.70
R1913:Topaz1 UTSW 9 122767013 missense possibly damaging 0.73
R1977:Topaz1 UTSW 9 122747362 missense unknown
R1989:Topaz1 UTSW 9 122750125 missense possibly damaging 0.86
R2237:Topaz1 UTSW 9 122771147 missense probably benign
R2238:Topaz1 UTSW 9 122771147 missense probably benign
R2239:Topaz1 UTSW 9 122771147 missense probably benign
R3160:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3161:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3162:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3821:Topaz1 UTSW 9 122797783 missense possibly damaging 0.85
R3822:Topaz1 UTSW 9 122797783 missense possibly damaging 0.85
R3944:Topaz1 UTSW 9 122750604 missense possibly damaging 0.73
R4571:Topaz1 UTSW 9 122747436 missense probably benign 0.01
R4580:Topaz1 UTSW 9 122747515 missense probably null 0.00
R5043:Topaz1 UTSW 9 122748404 missense probably benign
R5084:Topaz1 UTSW 9 122748818 missense probably benign 0.04
R5234:Topaz1 UTSW 9 122790193 missense possibly damaging 0.82
R5388:Topaz1 UTSW 9 122774093 missense possibly damaging 0.96
R5471:Topaz1 UTSW 9 122791416 intron probably null
R5706:Topaz1 UTSW 9 122799485 missense possibly damaging 0.53
R5993:Topaz1 UTSW 9 122749039 missense probably benign 0.00
R6104:Topaz1 UTSW 9 122749866 missense probably benign
R6137:Topaz1 UTSW 9 122797756 missense possibly damaging 0.53
R6186:Topaz1 UTSW 9 122748826 missense probably benign 0.33
R6209:Topaz1 UTSW 9 122750505 missense possibly damaging 0.85
R6543:Topaz1 UTSW 9 122748535 missense possibly damaging 0.53
R6548:Topaz1 UTSW 9 122748354 missense possibly damaging 0.53
R6557:Topaz1 UTSW 9 122748895 missense probably benign 0.02
R6637:Topaz1 UTSW 9 122749786 missense probably benign 0.33
R6859:Topaz1 UTSW 9 122801958 missense probably benign 0.33
R7123:Topaz1 UTSW 9 122748415 missense probably damaging 1.00
R7180:Topaz1 UTSW 9 122797705 missense possibly damaging 0.85
R7319:Topaz1 UTSW 9 122750363 missense possibly damaging 0.73
R7743:Topaz1 UTSW 9 122785136 missense probably benign 0.16
R7810:Topaz1 UTSW 9 122749185 missense probably benign 0.18
X0020:Topaz1 UTSW 9 122774069 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAAAGAACTACTGAGTCCTCAAG -3'
(R):5'- TTTAAAATTAGTCAGCCGTCCCG -3'

Sequencing Primer
(F):5'- CTACTGAGTCCTCAAGAAAAGAAATG -3'
(R):5'- AGCCGTCCCGTGTTTAATATTTTAAC -3'
Posted On2018-06-22