Mutagenetix > Incidental Mutations

Incidental Mutation 'R6603:Ap3d1'

525473

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R6603 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80714047 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 755 (S755P)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]

Predicted Effect

probably benign
Transcript: ENSMUST00000020420
AA Change: S755P

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: S755P

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

probably benign
Transcript: ENSMUST00000218610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219816

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	A	T	8: 24,665,502	F167Y	possibly damaging	Het
Aph1a	A	T	3: 95,895,496	N136I	probably damaging	Het
AU040320	T	A	4: 126,792,253	N207K	probably benign	Het
Caprin1	A	T	2: 103,775,511	D377E	probably benign	Het
Col18a1	A	G	10: 77,063,977		probably null	Het
Ddi2	T	C	4: 141,683,870	N577S	probably damaging	Het
Dip2c	T	A	13: 9,654,588		probably null	Het
Dmbt1	A	T	7: 131,046,510		probably null	Het
Fam13a	T	C	6: 58,987,189	K86R	probably benign	Het
Fam168b	C	A	1: 34,836,741	G21V	probably damaging	Het
Fam208a	A	G	14: 27,446,386	Y295C	probably damaging	Het
Fam71e2	G	A	7: 4,758,432	P427L	possibly damaging	Het
Fbxl8	A	T	8: 105,268,210	D118V	probably damaging	Het
Git2	C	A	5: 114,730,991		probably null	Het
Gm17190	T	G	13: 96,082,262	D35E	possibly damaging	Het
Gnb4	C	T	3: 32,585,146	D333N	probably damaging	Het
Has2	T	A	15: 56,668,572	D249V	probably damaging	Het
Ighv1-23	A	G	12: 114,764,521	S94P	probably damaging	Het
Itpr2	A	G	6: 146,347,171	I1029T	probably damaging	Het
Kctd16	T	C	18: 40,258,491	I44T	probably benign	Het
Kpna1	A	G	16: 36,029,520		probably null	Het
Lonrf1	T	A	8: 36,222,941	R654S	probably damaging	Het
Lrrc49	A	C	9: 60,593,769		probably null	Het
Miip	T	G	4: 147,865,923	K72T	possibly damaging	Het
Mink1	C	T	11: 70,609,593	P782S	probably damaging	Het
Mpped2	A	G	2: 106,866,977	T266A	probably benign	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Naip1	C	T	13: 100,423,158	G1113S	probably benign	Het
Nbr1	A	G	11: 101,556,105		probably benign	Het
Necab3	A	T	2: 154,554,922	N46K	probably damaging	Het
Olfr570	A	T	7: 102,900,414	I16F	probably benign	Het
Phtf1	C	T	3: 103,993,873	R360C	probably damaging	Het
Plcl2	A	G	17: 50,607,117	I385V	probably benign	Het
Prmt8	A	T	6: 127,729,413	F138L	probably benign	Het
Prpf40a	T	G	2: 53,152,963	R436S	probably damaging	Het
Rab27b	T	A	18: 69,985,304	I181F	probably damaging	Het
Rasgrf1	A	G	9: 89,910,257	E87G	probably damaging	Het
Scrib	T	A	15: 76,062,723	T674S	probably benign	Het
Slc9a4	A	G	1: 40,623,504	S644G	probably benign	Het
Slc9a9	G	A	9: 94,939,546	A329T	probably damaging	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Sox7	T	A	14: 63,948,188	H224Q	probably benign	Het
Spata31	T	C	13: 64,922,665	S876P	probably damaging	Het
Syndig1	G	A	2: 150,003,288	V244M	probably damaging	Het
Tas2r113	A	T	6: 132,893,458	I150L	probably benign	Het
Tmem59l	G	A	8: 70,486,356	P56L	probably benign	Het
Tnfrsf8	A	T	4: 145,292,598	D222E	possibly damaging	Het
Trim52	T	C	14: 106,107,049	L47P	probably damaging	Het
Ttc34	T	A	4: 154,839,305	I157K	probably benign	Het
Txndc16	A	G	14: 45,151,767	F492S	probably damaging	Het
Ubr4	A	G	4: 139,455,586	I428V	probably benign	Het
Vmn2r41	T	A	7: 8,138,360	I702F	probably damaging	Het
Wdr12	T	A	1: 60,082,624	H256L	probably damaging	Het
Xirp2	A	G	2: 67,516,544	H3043R	probably benign	Het
Xrcc1	C	T	7: 24,571,034	Q500*	probably null	Het
Zfp583	T	C	7: 6,325,476	N38S	probably damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GGCTTGTGCAACAGGTCAATG -3'
(R):5'- CTGAAAGTTCCAGGCAAGTGTC -3'

Sequencing Primer
(F):5'- CAGGTCAATGTGTGGCTATCTACAC -3'
(R):5'- TGGCTCTAAGCTCATAGTCAGGAC -3'

Posted On

2018-06-22