Incidental Mutation 'R6603:Ap3d1'
ID525473
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R6603 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80714047 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 755 (S755P)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]
Predicted Effect probably benign
Transcript: ENSMUST00000020420
AA Change: S755P

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: S755P

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218125
Predicted Effect probably benign
Transcript: ENSMUST00000218610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219816
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,665,502 F167Y possibly damaging Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Fbxl8 A T 8: 105,268,210 D118V probably damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lonrf1 T A 8: 36,222,941 R654S probably damaging Het
Lrrc49 A C 9: 60,593,769 probably null Het
Miip T G 4: 147,865,923 K72T possibly damaging Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tas2r113 A T 6: 132,893,458 I150L probably benign Het
Tmem59l G A 8: 70,486,356 P56L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Txndc16 A G 14: 45,151,767 F492S probably damaging Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Xrcc1 C T 7: 24,571,034 Q500* probably null Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 splice site probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80709458 missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80717844 missense probably damaging 1.00
R7964:Ap3d1 UTSW 10 80730057 missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80714301 missense probably benign 0.30
R8200:Ap3d1 UTSW 10 80722932 nonsense probably null
R8314:Ap3d1 UTSW 10 80723539 missense possibly damaging 0.91
R8356:Ap3d1 UTSW 10 80732903 missense probably damaging 1.00
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGCTTGTGCAACAGGTCAATG -3'
(R):5'- CTGAAAGTTCCAGGCAAGTGTC -3'

Sequencing Primer
(F):5'- CAGGTCAATGTGTGGCTATCTACAC -3'
(R):5'- TGGCTCTAAGCTCATAGTCAGGAC -3'
Posted On2018-06-22