Incidental Mutation 'R6636:Tmcc3'
ID525474
Institutional Source Beutler Lab
Gene Symbol Tmcc3
Ensembl Gene ENSMUSG00000020023
Gene Nametransmembrane and coiled coil domains 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location94311949-94590956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94578424 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 27 (V27E)
Ref Sequence ENSEMBL: ENSMUSP00000063264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065060] [ENSMUST00000117460] [ENSMUST00000117929] [ENSMUST00000121471] [ENSMUST00000132743] [ENSMUST00000148823] [ENSMUST00000148910]
Predicted Effect probably benign
Transcript: ENSMUST00000065060
AA Change: V27E

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000063264
Gene: ENSMUSG00000020023
AA Change: V27E

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 65 465 1.2e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117460
SMART Domains Protein: ENSMUSP00000112669
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117929
SMART Domains Protein: ENSMUSP00000112401
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121471
SMART Domains Protein: ENSMUSP00000113122
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132743
SMART Domains Protein: ENSMUSP00000119751
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 47 134 3.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146744
Predicted Effect probably benign
Transcript: ENSMUST00000148823
SMART Domains Protein: ENSMUSP00000119496
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 85 210 3.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148910
SMART Domains Protein: ENSMUSP00000121456
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 34 76 1.6e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Tmcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Tmcc3 APN 10 94582285 missense probably damaging 1.00
IGL01455:Tmcc3 APN 10 94586755 missense probably damaging 0.97
IGL02376:Tmcc3 APN 10 94578567 missense possibly damaging 0.85
IGL03073:Tmcc3 APN 10 94578951 missense probably benign 0.40
IGL03348:Tmcc3 APN 10 94579080 missense possibly damaging 0.95
R0131:Tmcc3 UTSW 10 94545575 splice site probably benign
R0360:Tmcc3 UTSW 10 94578545 missense probably benign
R0840:Tmcc3 UTSW 10 94578771 missense probably benign 0.05
R1994:Tmcc3 UTSW 10 94578606 missense possibly damaging 0.95
R1995:Tmcc3 UTSW 10 94578606 missense possibly damaging 0.95
R2184:Tmcc3 UTSW 10 94582306 missense probably damaging 1.00
R2197:Tmcc3 UTSW 10 94578918 missense probably damaging 1.00
R2273:Tmcc3 UTSW 10 94578915 missense probably damaging 0.97
R2274:Tmcc3 UTSW 10 94578915 missense probably damaging 0.97
R3763:Tmcc3 UTSW 10 94579317 missense probably benign 0.42
R4690:Tmcc3 UTSW 10 94545557 utr 5 prime probably benign
R4763:Tmcc3 UTSW 10 94579311 missense probably damaging 1.00
R4816:Tmcc3 UTSW 10 94578784 missense possibly damaging 0.89
R5385:Tmcc3 UTSW 10 94579153 missense probably damaging 1.00
R6177:Tmcc3 UTSW 10 94582387 missense probably damaging 0.97
R6898:Tmcc3 UTSW 10 94551172 intron probably null
R7128:Tmcc3 UTSW 10 94430634 start gained probably benign
R7313:Tmcc3 UTSW 10 94430572 start gained probably benign
R7320:Tmcc3 UTSW 10 94578495 missense possibly damaging 0.94
R7456:Tmcc3 UTSW 10 94582312 missense possibly damaging 0.79
R7874:Tmcc3 UTSW 10 94551027 critical splice donor site probably null
R7876:Tmcc3 UTSW 10 94578535 missense probably benign 0.03
R7957:Tmcc3 UTSW 10 94551027 critical splice donor site probably null
R7959:Tmcc3 UTSW 10 94578535 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAGATATAGGCTACAGTTGGGC -3'
(R):5'- AGATACTCTGCAACGTTCCC -3'

Sequencing Primer
(F):5'- CTTGACAGATGTGCCACA -3'
(R):5'- GGGACGTCTGCTCGATCTTTATC -3'
Posted On2018-06-22