Incidental Mutation 'R6636:Hfe'
ID525478
Institutional Source Beutler Lab
Gene Symbol Hfe
Ensembl Gene ENSMUSG00000006611
Gene Namehemochromatosis
SynonymsMR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23702034-23710854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 23706795 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 120 (E120D)
Ref Sequence ENSEMBL: ENSMUSP00000089299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006787] [ENSMUST00000091706] [ENSMUST00000091707]
Predicted Effect probably benign
Transcript: ENSMUST00000006787
SMART Domains Protein: ENSMUSP00000006787
Gene: ENSMUSG00000006611

DomainStartEndE-ValueType
IGc1 44 116 1.03e-14 SMART
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091706
AA Change: E208D

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089298
Gene: ENSMUSG00000006611
AA Change: E208D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 30 214 4e-46 PFAM
Pfam:MHC_I_3 53 212 7.4e-12 PFAM
IGc1 232 304 1.03e-14 SMART
transmembrane domain 318 340 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091707
AA Change: E120D

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089299
Gene: ENSMUSG00000006611
AA Change: E120D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 34 126 7.3e-24 PFAM
IGc1 144 216 1.03e-14 SMART
transmembrane domain 230 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151243
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene affects iron metabolism. Homozygotes for targeted null mutations exhibit increased intestinal iron absorption and an elevated hepatic iron load but reduced duodenal iron stores. Heterozygotes also accumulate more iron than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Hfe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Hfe APN 13 23705852 unclassified probably benign
IGL01733:Hfe APN 13 23706865 missense possibly damaging 0.51
IGL02227:Hfe APN 13 23706943 missense probably benign 0.26
IGL02339:Hfe APN 13 23704390 missense probably damaging 0.98
R1669:Hfe UTSW 13 23706127 nonsense probably null
R1704:Hfe UTSW 13 23704408 missense probably damaging 1.00
R4424:Hfe UTSW 13 23706883 missense probably benign 0.06
R4624:Hfe UTSW 13 23706078 nonsense probably null
R4904:Hfe UTSW 13 23708054 missense probably damaging 1.00
R5926:Hfe UTSW 13 23708264 missense probably damaging 0.99
R6246:Hfe UTSW 13 23708229 missense probably damaging 1.00
R6322:Hfe UTSW 13 23705896 missense probably damaging 1.00
R6636:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R6637:Hfe UTSW 13 23706795 missense possibly damaging 0.53
R6637:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R7167:Hfe UTSW 13 23708069 missense probably damaging 1.00
R7374:Hfe UTSW 13 23706047 missense probably damaging 0.99
R7816:Hfe UTSW 13 23704399 missense possibly damaging 0.53
Z1177:Hfe UTSW 13 23706037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCATCCCCAACAGTGG -3'
(R):5'- ATGACGGGCAAGATCACCTG -3'

Sequencing Primer
(F):5'- CATAGTGAGATCTAGACCAGCCTTG -3'
(R):5'- GGCAAGATCACCTGGAATTCTGC -3'
Posted On2018-06-22