Incidental Mutation 'R6603:Naip1'
ID525484
Institutional Source Beutler Lab
Gene Symbol Naip1
Ensembl Gene ENSMUSG00000021640
Gene NameNLR family, apoptosis inhibitory protein 1
SynonymsBirc1a, D13Lsd1, Naip
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6603 (G1)
Quality Score206.009
Status Not validated
Chromosome13
Chromosomal Location100407764-100452869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100423070 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1142 (S1142F)
Ref Sequence ENSEMBL: ENSMUSP00000152583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022142] [ENSMUST00000221727] [ENSMUST00000221943] [ENSMUST00000222155]
Predicted Effect probably benign
Transcript: ENSMUST00000022142
AA Change: S1142F

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022142
Gene: ENSMUSG00000021640
AA Change: S1142F

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.18e-20 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 7.82e-26 SMART
AAA 462 603 1.14e-2 SMART
low complexity region 908 919 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221727
Predicted Effect probably benign
Transcript: ENSMUST00000221943
Predicted Effect probably benign
Transcript: ENSMUST00000222155
AA Change: S1142F

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,665,502 F167Y possibly damaging Het
Ap3d1 A G 10: 80,714,047 S755P probably benign Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Fbxl8 A T 8: 105,268,210 D118V probably damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lonrf1 T A 8: 36,222,941 R654S probably damaging Het
Lrrc49 A C 9: 60,593,769 probably null Het
Miip T G 4: 147,865,923 K72T possibly damaging Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tas2r113 A T 6: 132,893,458 I150L probably benign Het
Tmem59l G A 8: 70,486,356 P56L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Txndc16 A G 14: 45,151,767 F492S probably damaging Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Xrcc1 C T 7: 24,571,034 Q500* probably null Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Naip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Naip1 APN 13 100443720 critical splice acceptor site probably null
IGL01145:Naip1 APN 13 100409121 missense probably benign 0.00
IGL01356:Naip1 APN 13 100423214 missense probably damaging 0.99
IGL01414:Naip1 APN 13 100409173 critical splice acceptor site probably null
IGL01505:Naip1 APN 13 100425933 missense probably damaging 1.00
IGL01573:Naip1 APN 13 100427382 missense probably benign 0.03
IGL01931:Naip1 APN 13 100409032 nonsense probably null
IGL02043:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02097:Naip1 APN 13 100425588 missense probably benign 0.03
IGL02331:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02627:Naip1 APN 13 100425648 missense possibly damaging 0.68
IGL02675:Naip1 APN 13 100409118 missense probably benign
IGL02801:Naip1 APN 13 100444368 missense probably damaging 1.00
IGL02851:Naip1 APN 13 100433262 missense probably damaging 1.00
IGL03038:Naip1 APN 13 100437333 nonsense probably null
IGL03399:Naip1 APN 13 100408918 missense probably damaging 1.00
FR4340:Naip1 UTSW 13 100423076 missense probably benign
FR4342:Naip1 UTSW 13 100425471 missense probably benign 0.00
R0051:Naip1 UTSW 13 100411001 missense probably damaging 0.96
R0095:Naip1 UTSW 13 100423083 missense probably benign 0.24
R0147:Naip1 UTSW 13 100426910 missense possibly damaging 0.67
R0375:Naip1 UTSW 13 100409148 missense probably benign 0.21
R0442:Naip1 UTSW 13 100444516 missense probably benign 0.00
R0455:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0491:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0614:Naip1 UTSW 13 100444200 missense probably benign 0.00
R0785:Naip1 UTSW 13 100423076 missense probably benign
R0785:Naip1 UTSW 13 100423085 missense probably benign 0.00
R0787:Naip1 UTSW 13 100426096 missense probably benign 0.22
R1081:Naip1 UTSW 13 100423070 missense probably benign 0.21
R1177:Naip1 UTSW 13 100427064 missense possibly damaging 0.91
R1476:Naip1 UTSW 13 100426870 missense probably benign 0.35
R1672:Naip1 UTSW 13 100423149 missense probably benign 0.00
R1809:Naip1 UTSW 13 100426239 missense probably benign
R2057:Naip1 UTSW 13 100425573 missense probably damaging 0.96
R2182:Naip1 UTSW 13 100413680 missense probably benign 0.01
R2395:Naip1 UTSW 13 100423106 missense possibly damaging 0.83
R2518:Naip1 UTSW 13 100423219 missense probably benign 0.00
R3033:Naip1 UTSW 13 100432458 missense probably benign 0.01
R3122:Naip1 UTSW 13 100408995 missense probably damaging 1.00
R3439:Naip1 UTSW 13 100423219 missense probably benign 0.00
R4167:Naip1 UTSW 13 100444286 missense probably benign 0.04
R4179:Naip1 UTSW 13 100426176 missense probably damaging 0.99
R4212:Naip1 UTSW 13 100426875 utr 3 prime probably null
R4639:Naip1 UTSW 13 100444283 missense probably benign 0.31
R4674:Naip1 UTSW 13 100444174 missense probably damaging 1.00
R4736:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4740:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4778:Naip1 UTSW 13 100426648 missense probably damaging 1.00
R4806:Naip1 UTSW 13 100425621 missense probably benign 0.00
R4855:Naip1 UTSW 13 100423220 unclassified probably null
R5740:Naip1 UTSW 13 100432501 critical splice acceptor site probably null
R5797:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R5806:Naip1 UTSW 13 100444735 start codon destroyed probably null 1.00
R5895:Naip1 UTSW 13 100423128 missense probably benign 0.00
R5896:Naip1 UTSW 13 100423128 missense probably benign 0.00
R6023:Naip1 UTSW 13 100426186 missense probably benign 0.00
R6109:Naip1 UTSW 13 100427182 missense probably damaging 1.00
R6117:Naip1 UTSW 13 100444737 start codon destroyed probably damaging 0.99
R6133:Naip1 UTSW 13 100444643 missense probably benign 0.10
R6241:Naip1 UTSW 13 100425661 missense probably damaging 0.99
R6335:Naip1 UTSW 13 100426552 missense probably damaging 1.00
R6404:Naip1 UTSW 13 100423219 missense probably benign 0.00
R6475:Naip1 UTSW 13 100409088 missense probably damaging 1.00
R6508:Naip1 UTSW 13 100436465 missense probably damaging 1.00
R6580:Naip1 UTSW 13 100444649 missense probably damaging 0.99
R6600:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6600:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6603:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6633:Naip1 UTSW 13 100423076 missense probably benign
R6633:Naip1 UTSW 13 100423085 missense probably benign 0.00
R6720:Naip1 UTSW 13 100423077 missense probably benign 0.00
R6805:Naip1 UTSW 13 100427341 missense probably benign 0.04
R7043:Naip1 UTSW 13 100426914 missense probably damaging 1.00
R7615:Naip1 UTSW 13 100425776 missense probably benign 0.00
X0066:Naip1 UTSW 13 100437322 missense probably damaging 1.00
Y4335:Naip1 UTSW 13 100425522 missense probably benign 0.00
Y4336:Naip1 UTSW 13 100425522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATGAATAAGAACACTGATCCCAC -3'
(R):5'- TGGCTGAAGCACCTTGAGAAC -3'

Sequencing Primer
(F):5'- TGATCCCACCCCATCCCAG -3'
(R):5'- GAAGCACCTTGAGAACTTGCACTTG -3'
Posted On2018-06-22