Incidental Mutation 'R6636:Ttll1'
ID525489
Institutional Source Beutler Lab
Gene Symbol Ttll1
Ensembl Gene ENSMUSG00000022442
Gene Nametubulin tyrosine ligase-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location83483769-83510893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 83499946 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Serine at position 160 (W160S)
Ref Sequence ENSEMBL: ENSMUSP00000105105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016897] [ENSMUST00000109479] [ENSMUST00000109480] [ENSMUST00000154401]
Predicted Effect probably damaging
Transcript: ENSMUST00000016897
AA Change: W160S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016897
Gene: ENSMUSG00000022442
AA Change: W160S

DomainStartEndE-ValueType
Pfam:TTL 50 364 5.3e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109479
AA Change: W160S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105105
Gene: ENSMUSG00000022442
AA Change: W160S

DomainStartEndE-ValueType
Pfam:TTL 49 297 1.5e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109480
AA Change: W160S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105106
Gene: ENSMUSG00000022442
AA Change: W160S

DomainStartEndE-ValueType
Pfam:TTL 50 364 6.6e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154401
SMART Domains Protein: ENSMUSP00000117790
Gene: ENSMUSG00000022442

DomainStartEndE-ValueType
Pfam:TTL 48 89 9e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit short sperm flagellum, abnormal tracheal cilia morphology and function, abnormal mucociliary clearance, and rhinosinitus with coughing or sneezing-like noises. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Ttll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Ttll1 APN 15 83484249 missense probably benign
IGL02744:Ttll1 APN 15 83489577 missense probably benign 0.00
R0639:Ttll1 UTSW 15 83502225 nonsense probably null
R1248:Ttll1 UTSW 15 83502125 missense probably benign 0.13
R1581:Ttll1 UTSW 15 83496277 missense probably damaging 0.99
R1599:Ttll1 UTSW 15 83497354 missense probably benign 0.36
R2264:Ttll1 UTSW 15 83496408 missense probably damaging 1.00
R2923:Ttll1 UTSW 15 83492559 missense probably damaging 0.97
R3786:Ttll1 UTSW 15 83484218 missense probably benign 0.00
R4200:Ttll1 UTSW 15 83492577 missense probably damaging 1.00
R4364:Ttll1 UTSW 15 83499994 missense probably damaging 0.99
R4473:Ttll1 UTSW 15 83492609 missense probably damaging 0.99
R4590:Ttll1 UTSW 15 83497345 missense probably damaging 1.00
R4949:Ttll1 UTSW 15 83502173 missense probably null 1.00
R4970:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5112:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5231:Ttll1 UTSW 15 83489466 splice site probably null
R5911:Ttll1 UTSW 15 83502281 missense probably benign 0.07
R6368:Ttll1 UTSW 15 83489617 missense probably damaging 1.00
R6959:Ttll1 UTSW 15 83502196 nonsense probably null
R7848:Ttll1 UTSW 15 83497372 missense probably damaging 0.97
R8207:Ttll1 UTSW 15 83500078 missense probably damaging 1.00
R8240:Ttll1 UTSW 15 83492582 missense probably damaging 1.00
R8717:Ttll1 UTSW 15 83489508 missense probably benign 0.01
Z1088:Ttll1 UTSW 15 83498189 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCATGACCTGTACCACATGCC -3'
(R):5'- ACTTCTTATGGCAATGGGTGTC -3'

Sequencing Primer
(F):5'- TGTACCACATGCCCCATGG -3'
(R):5'- CAATGGGTGTCTTTACTTCAGAC -3'
Posted On2018-06-22