Incidental Mutation 'R6603:Txndc16'
ID525490
Institutional Source Beutler Lab
Gene Symbol Txndc16
Ensembl Gene ENSMUSG00000021830
Gene Namethioredoxin domain containing 16
Synonyms5730420B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6603 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location45133465-45220328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45151767 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 492 (F492S)
Ref Sequence ENSEMBL: ENSMUSP00000120287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022377] [ENSMUST00000123879] [ENSMUST00000139526]
Predicted Effect probably damaging
Transcript: ENSMUST00000022377
AA Change: F492S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022377
Gene: ENSMUSG00000021830
AA Change: F492S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123879
AA Change: F492S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123023
Gene: ENSMUSG00000021830
AA Change: F492S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139526
AA Change: F492S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120287
Gene: ENSMUSG00000021830
AA Change: F492S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1e-12 PFAM
Pfam:Thioredoxin_6 534 723 7.3e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,665,502 F167Y possibly damaging Het
Ap3d1 A G 10: 80,714,047 S755P probably benign Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Fbxl8 A T 8: 105,268,210 D118V probably damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lonrf1 T A 8: 36,222,941 R654S probably damaging Het
Lrrc49 A C 9: 60,593,769 probably null Het
Miip T G 4: 147,865,923 K72T possibly damaging Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tas2r113 A T 6: 132,893,458 I150L probably benign Het
Tmem59l G A 8: 70,486,356 P56L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Xrcc1 C T 7: 24,571,034 Q500* probably null Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Txndc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Txndc16 APN 14 45162350 missense probably damaging 0.99
IGL00427:Txndc16 APN 14 45145090 splice site probably benign
IGL02554:Txndc16 APN 14 45172538 missense probably damaging 1.00
IGL02666:Txndc16 APN 14 45211150 splice site probably benign
IGL02707:Txndc16 APN 14 45162273 missense probably benign
IGL03198:Txndc16 APN 14 45151484 splice site probably benign
IGL03256:Txndc16 APN 14 45151896 missense probably damaging 1.00
R0647:Txndc16 UTSW 14 45169275 missense probably damaging 1.00
R0647:Txndc16 UTSW 14 45165361 nonsense probably null
R0838:Txndc16 UTSW 14 45165419 splice site probably benign
R1035:Txndc16 UTSW 14 45172563 missense possibly damaging 0.92
R1116:Txndc16 UTSW 14 45162985 missense probably benign 0.06
R1511:Txndc16 UTSW 14 45151887 missense probably damaging 0.97
R2114:Txndc16 UTSW 14 45145027 missense probably benign 0.00
R2139:Txndc16 UTSW 14 45172589 missense probably damaging 1.00
R3784:Txndc16 UTSW 14 45165886 missense probably damaging 1.00
R3801:Txndc16 UTSW 14 45151352 missense possibly damaging 0.85
R5215:Txndc16 UTSW 14 45211140 intron probably benign
R5620:Txndc16 UTSW 14 45135878 missense possibly damaging 0.86
R5726:Txndc16 UTSW 14 45165764 missense probably benign 0.38
R6297:Txndc16 UTSW 14 45151786 missense probably benign 0.10
R6626:Txndc16 UTSW 14 45161335 splice site probably null
R6876:Txndc16 UTSW 14 45163040 missense possibly damaging 0.55
R7102:Txndc16 UTSW 14 45205382 missense probably benign 0.00
R7166:Txndc16 UTSW 14 45183154 missense probably benign 0.22
R7465:Txndc16 UTSW 14 45165388 missense probably damaging 0.97
R7670:Txndc16 UTSW 14 45135867 nonsense probably null
R7684:Txndc16 UTSW 14 45147868 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGACAGGAGATCTTATTCCTGG -3'
(R):5'- TTTGATTCAGGCAGGTCCAC -3'

Sequencing Primer
(F):5'- ACAGAACCTAGCAAACAATAGATTAC -3'
(R):5'- GATTCAGGCAGGTCCACCATCC -3'
Posted On2018-06-22