Mutagenetix > Incidental Mutation

Incidental Mutation 'R6603:Plcl2'

525502

Institutional Source

Beutler Lab

Gene Symbol

Plcl2

Ensembl Gene

ENSMUSG00000038910

Gene Name

phospholipase C-like 2

Synonyms

PRIP-2, Plce2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.271) question?

Stock #

R6603 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

50509547-50688493 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50607117 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 385 (I385V)

Ref Sequence

ENSEMBL: ENSMUSP00000046584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043938]

AlphaFold

Q8K394

Predicted Effect

probably benign
Transcript: ENSMUST00000043938
AA Change: I385V

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: I385V

Domain	Start	End	E-Value	Type
low complexity region	20	49	N/A	INTRINSIC
PH	143	254	2.88e-5	SMART
Pfam:EF-hand_like	344	426	3.7e-29	PFAM
PLCXc	427	571	2.19e-84	SMART
PLCYc	619	735	4.37e-61	SMART
C2	756	862	3.45e-19	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	A	T	8: 24,665,502	F167Y	possibly damaging	Het
Ap3d1	A	G	10: 80,714,047	S755P	probably benign	Het
Aph1a	A	T	3: 95,895,496	N136I	probably damaging	Het
AU040320	T	A	4: 126,792,253	N207K	probably benign	Het
Caprin1	A	T	2: 103,775,511	D377E	probably benign	Het
Col18a1	A	G	10: 77,063,977		probably null	Het
Ddi2	T	C	4: 141,683,870	N577S	probably damaging	Het
Dip2c	T	A	13: 9,654,588		probably null	Het
Dmbt1	A	T	7: 131,046,510		probably null	Het
Fam13a	T	C	6: 58,987,189	K86R	probably benign	Het
Fam168b	C	A	1: 34,836,741	G21V	probably damaging	Het
Fam208a	A	G	14: 27,446,386	Y295C	probably damaging	Het
Fam71e2	G	A	7: 4,758,432	P427L	possibly damaging	Het
Fbxl8	A	T	8: 105,268,210	D118V	probably damaging	Het
Git2	C	A	5: 114,730,991		probably null	Het
Gm17190	T	G	13: 96,082,262	D35E	possibly damaging	Het
Gnb4	C	T	3: 32,585,146	D333N	probably damaging	Het
Has2	T	A	15: 56,668,572	D249V	probably damaging	Het
Ighv1-23	A	G	12: 114,764,521	S94P	probably damaging	Het
Itpr2	A	G	6: 146,347,171	I1029T	probably damaging	Het
Kctd16	T	C	18: 40,258,491	I44T	probably benign	Het
Kpna1	A	G	16: 36,029,520		probably null	Het
Lonrf1	T	A	8: 36,222,941	R654S	probably damaging	Het
Lrrc49	A	C	9: 60,593,769		probably null	Het
Miip	T	G	4: 147,865,923	K72T	possibly damaging	Het
Mink1	C	T	11: 70,609,593	P782S	probably damaging	Het
Mpped2	A	G	2: 106,866,977	T266A	probably benign	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Naip1	C	T	13: 100,423,158	G1113S	probably benign	Het
Nbr1	A	G	11: 101,556,105		probably benign	Het
Necab3	A	T	2: 154,554,922	N46K	probably damaging	Het
Olfr570	A	T	7: 102,900,414	I16F	probably benign	Het
Phtf1	C	T	3: 103,993,873	R360C	probably damaging	Het
Prmt8	A	T	6: 127,729,413	F138L	probably benign	Het
Prpf40a	T	G	2: 53,152,963	R436S	probably damaging	Het
Rab27b	T	A	18: 69,985,304	I181F	probably damaging	Het
Rasgrf1	A	G	9: 89,910,257	E87G	probably damaging	Het
Scrib	T	A	15: 76,062,723	T674S	probably benign	Het
Slc9a4	A	G	1: 40,623,504	S644G	probably benign	Het
Slc9a9	G	A	9: 94,939,546	A329T	probably damaging	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Sox7	T	A	14: 63,948,188	H224Q	probably benign	Het
Spata31	T	C	13: 64,922,665	S876P	probably damaging	Het
Syndig1	G	A	2: 150,003,288	V244M	probably damaging	Het
Tas2r113	A	T	6: 132,893,458	I150L	probably benign	Het
Tmem59l	G	A	8: 70,486,356	P56L	probably benign	Het
Tnfrsf8	A	T	4: 145,292,598	D222E	possibly damaging	Het
Trim52	T	C	14: 106,107,049	L47P	probably damaging	Het
Ttc34	T	A	4: 154,839,305	I157K	probably benign	Het
Txndc16	A	G	14: 45,151,767	F492S	probably damaging	Het
Ubr4	A	G	4: 139,455,586	I428V	probably benign	Het
Vmn2r41	T	A	7: 8,138,360	I702F	probably damaging	Het
Wdr12	T	A	1: 60,082,624	H256L	probably damaging	Het
Xirp2	A	G	2: 67,516,544	H3043R	probably benign	Het
Xrcc1	C	T	7: 24,571,034	Q500*	probably null	Het
Zfp583	T	C	7: 6,325,476	N38S	probably damaging	Het

Other mutations in Plcl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Plcl2	APN	17	50606920	missense	probably benign	0.01
IGL01746:Plcl2	APN	17	50607696	missense	probably benign	0.00
IGL02227:Plcl2	APN	17	50606397	missense	probably damaging	0.97
IGL02232:Plcl2	APN	17	50606641	missense	possibly damaging	0.66
IGL02878:Plcl2	APN	17	50607355	missense	probably damaging	1.00
IGL02985:Plcl2	APN	17	50687814	nonsense	probably null
acerbic	UTSW	17	50608113	missense	probably damaging	1.00
Balsamic	UTSW	17	50607661	missense	probably damaging	1.00
Bastante	UTSW	17	50606361	nonsense	probably null
italietta	UTSW	17	50608762	missense	probably damaging	1.00
Oxalic	UTSW	17	50608099	missense	probably damaging	1.00
Parece	UTSW	17	50607846	missense	probably damaging	0.99
picolinic	UTSW	17	50668160	splice site	probably null
ranch	UTSW	17	50509929	missense	probably benign	0.00
verdad	UTSW	17	50608081	missense	probably damaging	1.00
vinagrette	UTSW	17	50606856	nonsense	probably null
BB007:Plcl2	UTSW	17	50606803	missense	probably benign
BB017:Plcl2	UTSW	17	50606803	missense	probably benign
IGL03014:Plcl2	UTSW	17	50611001	missense	possibly damaging	0.65
R0110:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0190:Plcl2	UTSW	17	50607643	missense	probably benign
R0280:Plcl2	UTSW	17	50607034	missense	probably damaging	1.00
R0414:Plcl2	UTSW	17	50607955	missense	possibly damaging	0.90
R0450:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0760:Plcl2	UTSW	17	50608774	missense	possibly damaging	0.82
R1134:Plcl2	UTSW	17	50608110	missense	probably benign
R1168:Plcl2	UTSW	17	50607072	missense	possibly damaging	0.49
R1381:Plcl2	UTSW	17	50607729	missense	probably damaging	0.99
R1748:Plcl2	UTSW	17	50606798	missense	probably benign
R1856:Plcl2	UTSW	17	50607850	missense	probably benign	0.13
R1958:Plcl2	UTSW	17	50608081	missense	probably damaging	1.00
R2016:Plcl2	UTSW	17	50606694	missense	probably damaging	1.00
R2057:Plcl2	UTSW	17	50668111	splice site	probably null
R2077:Plcl2	UTSW	17	50606829	missense	probably benign
R2247:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R3083:Plcl2	UTSW	17	50687744	missense	probably benign	0.06
R4153:Plcl2	UTSW	17	50606361	nonsense	probably null
R4574:Plcl2	UTSW	17	50607846	missense	probably damaging	0.99
R4870:Plcl2	UTSW	17	50607226	missense	possibly damaging	0.46
R5030:Plcl2	UTSW	17	50607319	missense	possibly damaging	0.92
R5330:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5331:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5503:Plcl2	UTSW	17	50509929	missense	probably benign	0.00
R5920:Plcl2	UTSW	17	50608675	missense	probably damaging	0.99
R6238:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R6378:Plcl2	UTSW	17	50668160	splice site	probably null
R6633:Plcl2	UTSW	17	50640140	missense	probably benign	0.00
R7113:Plcl2	UTSW	17	50606464	missense	probably damaging	1.00
R7466:Plcl2	UTSW	17	50608468	missense	probably damaging	1.00
R7665:Plcl2	UTSW	17	50607157	missense	probably benign	0.00
R7930:Plcl2	UTSW	17	50606803	missense	probably benign
R8114:Plcl2	UTSW	17	50687787	missense	probably damaging	0.97
R8152:Plcl2	UTSW	17	50607661	missense	probably damaging	1.00
R8208:Plcl2	UTSW	17	50608315	missense	probably damaging	1.00
R8853:Plcl2	UTSW	17	50606856	nonsense	probably null
R8911:Plcl2	UTSW	17	50608113	missense	probably damaging	1.00
R8940:Plcl2	UTSW	17	50608762	missense	probably damaging	1.00
R8979:Plcl2	UTSW	17	50640117	missense	possibly damaging	0.64
R9127:Plcl2	UTSW	17	50611004	missense	probably benign	0.05
R9253:Plcl2	UTSW	17	50608099	missense	probably damaging	1.00
R9453:Plcl2	UTSW	17	50608363	missense	probably damaging	1.00
R9469:Plcl2	UTSW	17	50606925	missense	probably benign	0.05
R9630:Plcl2	UTSW	17	50640119	missense	probably benign
X0026:Plcl2	UTSW	17	50607560	missense	probably benign	0.03
Z1088:Plcl2	UTSW	17	50606992	missense	probably damaging	1.00
Z1176:Plcl2	UTSW	17	50608456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAAAGGAGGAATTTATTGAGGTC -3'
(R):5'- TTCAGAGCGCGGATATATCCC -3'

Sequencing Primer
(F):5'- GTCTTTCATGAACTTTGTACTAGACC -3'
(R):5'- CGGATATATCCCGTGATGTCAGAG -3'

Posted On

2018-06-22