Incidental Mutation 'R6637:Olfr1197'
ID525508
Institutional Source Beutler Lab
Gene Symbol Olfr1197
Ensembl Gene ENSMUSG00000075119
Gene Nameolfactory receptor 1197
SynonymsMOR225-10P, GA_x6K02T2Q125-50202854-50201910, MOR225-14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6637 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88726903-88732366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88728841 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 253 (I253V)
Ref Sequence ENSEMBL: ENSMUSP00000150290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099815] [ENSMUST00000213118]
Predicted Effect probably benign
Transcript: ENSMUST00000099815
AA Change: I253V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097403
Gene: ENSMUSG00000075119
AA Change: I253V

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 1.3e-45 PFAM
Pfam:7tm_1 39 285 7.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213118
AA Change: I253V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Adh1 T A 3: 138,282,470 C98* probably null Het
Alms1 A G 6: 85,619,734 H514R possibly damaging Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Col3a1 C T 1: 45,347,730 T234I probably damaging Het
Cxadr C T 16: 78,333,503 T186M possibly damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fbxo16 A G 14: 65,295,761 probably null Het
Fign A G 2: 64,027,908 probably benign Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Invs G A 4: 48,416,203 probably null Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Kcnk5 A C 14: 20,144,721 M183R probably null Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Lrrc8b A C 5: 105,480,271 D161A possibly damaging Het
Lrriq1 A T 10: 103,221,432 F169Y probably benign Het
Lsamp T A 16: 41,533,381 V2D possibly damaging Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Olfr1095 T G 2: 86,851,440 K86T probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Spa17 A T 9: 37,611,974 S6T probably benign Het
Ston2 G C 12: 91,714,112 T126S probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tbr1 A G 2: 61,811,630 D150G probably benign Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Ubxn4 C A 1: 128,277,087 Q505K probably damaging Het
Vcl A G 14: 21,003,132 E405G probably damaging Het
Vmn2r26 A T 6: 124,061,691 I742F probably damaging Het
Other mutations in Olfr1197
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1197 APN 2 88729065 missense probably damaging 1.00
IGL01515:Olfr1197 APN 2 88729008 missense probably benign
IGL01822:Olfr1197 APN 2 88728792 missense probably benign 0.03
IGL02060:Olfr1197 APN 2 88729563 missense probably damaging 0.98
IGL02466:Olfr1197 APN 2 88729395 missense probably damaging 1.00
IGL02698:Olfr1197 APN 2 88729471 missense probably damaging 1.00
R0336:Olfr1197 UTSW 2 88729154 missense possibly damaging 0.47
R1037:Olfr1197 UTSW 2 88729032 missense probably damaging 1.00
R1120:Olfr1197 UTSW 2 88728937 missense probably damaging 1.00
R1674:Olfr1197 UTSW 2 88729257 missense probably damaging 0.99
R1801:Olfr1197 UTSW 2 88729264 missense probably damaging 1.00
R1860:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R1861:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R2049:Olfr1197 UTSW 2 88728745 missense probably damaging 1.00
R2308:Olfr1197 UTSW 2 88729084 missense probably damaging 0.97
R2411:Olfr1197 UTSW 2 88729397 missense probably benign 0.06
R4707:Olfr1197 UTSW 2 88728712 missense possibly damaging 0.62
R5000:Olfr1197 UTSW 2 88729566 missense probably damaging 0.96
R5157:Olfr1197 UTSW 2 88729548 missense probably benign
R6000:Olfr1197 UTSW 2 88729231 missense probably damaging 1.00
R6021:Olfr1197 UTSW 2 88728950 nonsense probably null
R6389:Olfr1197 UTSW 2 88728672 missense probably benign 0.00
R6636:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6979:Olfr1197 UTSW 2 88729184 missense probably benign 0.03
R7618:Olfr1197 UTSW 2 88728836 nonsense probably null
R8382:Olfr1197 UTSW 2 88729513 missense probably damaging 0.98
X0020:Olfr1197 UTSW 2 88729381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAACTCTGAGTGACAGCCG -3'
(R):5'- TTGTGTGACATCAAGCCTCTTC -3'

Sequencing Primer
(F):5'- GAGACCACACCTTGTGCATG -3'
(R):5'- GACATCAAGCCTCTTCTGAAATTGG -3'
Posted On2018-06-22