Incidental Mutation 'R6637:Tgm7'
ID 525510
Institutional Source Beutler Lab
Gene Symbol Tgm7
Ensembl Gene ENSMUSG00000079103
Gene Name transglutaminase 7
Synonyms TGz
MMRRC Submission 044758-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R6637 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120924046-120946877 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120931571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 197 (R197S)
Ref Sequence ENSEMBL: ENSMUSP00000106303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110675]
AlphaFold A2ART8
Predicted Effect probably damaging
Transcript: ENSMUST00000110675
AA Change: R197S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106303
Gene: ENSMUSG00000079103
AA Change: R197S

DomainStartEndE-ValueType
TGc 177 270 2.54e-42 SMART
SCOP:d1kv3a2 395 512 1e-33 SMART
Pfam:Transglut_C 514 612 1.7e-20 PFAM
Meta Mutation Damage Score 0.9016 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases (TGM; EC 2.3.2.13) are a family of structurally and functionally related enzymes that stabilize protein assemblies through the formation of gamma-glutamyl-epsilon lysine crosslinks. For additional background information on transglutaminases, see TGM1 (MIM 190195).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 G A 3: 151,223,410 (GRCm39) W621* probably null Het
Adh1 T A 3: 137,988,231 (GRCm39) C98* probably null Het
Alms1 A G 6: 85,596,716 (GRCm39) H514R possibly damaging Het
Ap4m1 A G 5: 138,170,437 (GRCm39) probably benign Het
Atp6v1b2 T C 8: 69,554,026 (GRCm39) Y68H probably damaging Het
Cdh3 G C 8: 107,237,973 (GRCm39) V56L probably benign Het
Col3a1 C T 1: 45,386,890 (GRCm39) T234I probably damaging Het
Cxadr C T 16: 78,130,391 (GRCm39) T186M possibly damaging Het
Dmgdh A T 13: 93,845,706 (GRCm39) E453D probably benign Het
Fbxo16 A G 14: 65,533,210 (GRCm39) probably null Het
Fign A G 2: 63,858,252 (GRCm39) probably benign Het
Hfe C G 13: 23,890,778 (GRCm39) E120D possibly damaging Het
Hfe T C 13: 23,890,779 (GRCm39) E120G possibly damaging Het
Invs G A 4: 48,416,203 (GRCm39) probably null Het
Kcnb1 T C 2: 166,947,774 (GRCm39) D358G probably damaging Het
Kcnk5 A C 14: 20,194,789 (GRCm39) M183R probably null Het
Lamp3 A G 16: 19,519,983 (GRCm39) F67L probably benign Het
Lrrc8b A C 5: 105,628,137 (GRCm39) D161A possibly damaging Het
Lrriq1 A T 10: 103,057,293 (GRCm39) F169Y probably benign Het
Lsamp T A 16: 41,353,743 (GRCm39) V2D possibly damaging Het
Ltbp2 T C 12: 84,922,612 (GRCm39) I132V probably benign Het
Muc4 C T 16: 32,575,255 (GRCm39) P1280L probably benign Het
Muc5ac T C 7: 141,372,342 (GRCm39) Y2659H possibly damaging Het
Or2g7 G A 17: 38,378,115 (GRCm39) D18N probably damaging Het
Or4a27 T C 2: 88,559,185 (GRCm39) I253V probably benign Het
Or5b113 T C 19: 13,342,589 (GRCm39) V199A probably benign Het
Or5t15 T G 2: 86,681,784 (GRCm39) K86T probably benign Het
Spa17 A T 9: 37,523,270 (GRCm39) S6T probably benign Het
Ston2 G C 12: 91,680,886 (GRCm39) T126S probably damaging Het
Tal1 A G 4: 114,925,789 (GRCm39) N286S probably damaging Het
Tbr1 A G 2: 61,641,974 (GRCm39) D150G probably benign Het
Topaz1 A T 9: 122,578,851 (GRCm39) Q587L probably benign Het
Ubxn4 C A 1: 128,204,824 (GRCm39) Q505K probably damaging Het
Vcl A G 14: 21,053,200 (GRCm39) E405G probably damaging Het
Vmn2r26 A T 6: 124,038,650 (GRCm39) I742F probably damaging Het
Other mutations in Tgm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Tgm7 APN 2 120,937,396 (GRCm39) missense probably benign 0.16
IGL01576:Tgm7 APN 2 120,931,514 (GRCm39) missense probably damaging 1.00
IGL01982:Tgm7 APN 2 120,924,106 (GRCm39) nonsense probably null
IGL02077:Tgm7 APN 2 120,934,316 (GRCm39) missense probably damaging 1.00
IGL02135:Tgm7 APN 2 120,929,519 (GRCm39) missense possibly damaging 0.75
R0063:Tgm7 UTSW 2 120,924,577 (GRCm39) missense probably benign 0.01
R0412:Tgm7 UTSW 2 120,931,546 (GRCm39) missense probably damaging 1.00
R1869:Tgm7 UTSW 2 120,931,570 (GRCm39) missense probably damaging 1.00
R2201:Tgm7 UTSW 2 120,929,062 (GRCm39) missense probably damaging 1.00
R2276:Tgm7 UTSW 2 120,929,045 (GRCm39) missense probably damaging 1.00
R2279:Tgm7 UTSW 2 120,929,045 (GRCm39) missense probably damaging 1.00
R2872:Tgm7 UTSW 2 120,940,174 (GRCm39) start gained probably benign
R2872:Tgm7 UTSW 2 120,940,174 (GRCm39) start gained probably benign
R4523:Tgm7 UTSW 2 120,929,069 (GRCm39) critical splice acceptor site probably null
R4688:Tgm7 UTSW 2 120,924,502 (GRCm39) missense probably benign 0.06
R4757:Tgm7 UTSW 2 120,926,870 (GRCm39) missense possibly damaging 0.75
R4858:Tgm7 UTSW 2 120,929,445 (GRCm39) critical splice donor site probably null
R5132:Tgm7 UTSW 2 120,934,700 (GRCm39) missense probably damaging 1.00
R5141:Tgm7 UTSW 2 120,931,480 (GRCm39) missense probably benign 0.05
R5424:Tgm7 UTSW 2 120,929,522 (GRCm39) missense probably damaging 1.00
R5911:Tgm7 UTSW 2 120,926,454 (GRCm39) missense probably benign 0.27
R6166:Tgm7 UTSW 2 120,929,539 (GRCm39) missense probably damaging 1.00
R6364:Tgm7 UTSW 2 120,926,878 (GRCm39) nonsense probably null
R6636:Tgm7 UTSW 2 120,931,571 (GRCm39) missense probably damaging 1.00
R6950:Tgm7 UTSW 2 120,924,128 (GRCm39) missense probably damaging 1.00
R7094:Tgm7 UTSW 2 120,929,489 (GRCm39) missense probably damaging 1.00
R7536:Tgm7 UTSW 2 120,926,878 (GRCm39) nonsense probably null
R7729:Tgm7 UTSW 2 120,924,191 (GRCm39) missense probably benign
R7822:Tgm7 UTSW 2 120,934,421 (GRCm39) missense probably benign
R8213:Tgm7 UTSW 2 120,931,545 (GRCm39) missense probably damaging 0.99
R8511:Tgm7 UTSW 2 120,924,141 (GRCm39) missense probably damaging 0.99
R9182:Tgm7 UTSW 2 120,926,980 (GRCm39) missense probably benign
R9490:Tgm7 UTSW 2 120,928,867 (GRCm39) missense probably damaging 0.99
R9573:Tgm7 UTSW 2 120,934,606 (GRCm39) missense probably benign
R9656:Tgm7 UTSW 2 120,940,191 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TACAGGACAGTCACACATCCAAG -3'
(R):5'- CAGGTGAGCAGATGGGCATG -3'

Sequencing Primer
(F):5'- GGCAAGCGAATCCGTTTCATC -3'
(R):5'- CAGATGGGCATGTGGGTAG -3'
Posted On 2018-06-22