Incidental Mutation 'R6604:Ppig'
ID525517
Institutional Source Beutler Lab
Gene Symbol Ppig
Ensembl Gene ENSMUSG00000042133
Gene Namepeptidyl-prolyl isomerase G (cyclophilin G)
SynonymsSRCyp, B230312B02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R6604 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69722545-69754012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69741581 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 215 (S215P)
Ref Sequence ENSEMBL: ENSMUSP00000088370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040915] [ENSMUST00000090858]
Predicted Effect unknown
Transcript: ENSMUST00000040915
AA Change: S215P
SMART Domains Protein: ENSMUSP00000045945
Gene: ENSMUSG00000042133
AA Change: S215P

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.8e-50 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000090858
AA Change: S215P
SMART Domains Protein: ENSMUSP00000088370
Gene: ENSMUSG00000042133
AA Change: S215P

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.7e-49 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143954
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,439,579 probably benign Het
Abca13 T G 11: 9,378,384 F3486V probably damaging Het
Adcy9 A G 16: 4,304,407 L830P probably damaging Het
Aurkb T A 11: 69,048,562 L157* probably null Het
Bbs10 T G 10: 111,301,104 L693V possibly damaging Het
Dna2 G T 10: 62,967,743 probably null Het
Ext1 A G 15: 53,083,159 F550L probably damaging Het
Gm11639 T A 11: 104,698,946 L123* probably null Het
Gm13101 T C 4: 143,965,997 R145G probably benign Het
Gm5129 A G 5: 29,735,767 probably benign Het
Golm1 A G 13: 59,638,383 Y332H probably damaging Het
Gpbp1l1 C T 4: 116,573,505 P58S probably benign Het
Grk4 A T 5: 34,719,864 D301V probably damaging Het
Haus1 T C 18: 77,764,097 E106G probably damaging Het
Hpd T C 5: 123,180,901 probably null Het
Kcnj6 C A 16: 94,762,645 E313D probably damaging Het
Lmna A G 3: 88,488,282 V57A probably damaging Het
Lrrtm1 T C 6: 77,244,238 F226S possibly damaging Het
Otogl T C 10: 107,822,034 probably null Het
Pgr A C 9: 8,946,866 T703P possibly damaging Het
Rasgrp3 A C 17: 75,503,115 N270T probably benign Het
Rp1 C A 1: 4,019,128 K1305N unknown Het
Shc1 A G 3: 89,421,879 Y10C probably damaging Het
Slc12a1 G T 2: 125,184,815 D457Y probably damaging Het
Sncaip A G 18: 52,905,846 Q544R possibly damaging Het
Socs5 T C 17: 87,135,125 Y498H probably damaging Het
Szt2 T C 4: 118,385,474 D1472G probably benign Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmem236 A G 2: 14,174,701 T38A probably benign Het
Vmn2r29 A T 7: 7,231,859 V676E probably damaging Het
Vps13d A G 4: 145,181,124 V56A probably damaging Het
Xirp2 T C 2: 67,509,845 I810T possibly damaging Het
Zfp958 T C 8: 4,628,245 L90P probably damaging Het
Other mutations in Ppig
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Ppig APN 2 69749716 missense unknown
IGL00780:Ppig APN 2 69732924 missense possibly damaging 0.89
IGL02043:Ppig APN 2 69735983 splice site probably null
IGL02420:Ppig APN 2 69732227 missense probably benign 0.03
IGL02736:Ppig APN 2 69736094 missense probably damaging 1.00
R0358:Ppig UTSW 2 69743598 splice site probably benign
R0396:Ppig UTSW 2 69735976 unclassified probably benign
R1035:Ppig UTSW 2 69749459 missense unknown
R1159:Ppig UTSW 2 69750224 missense unknown
R1396:Ppig UTSW 2 69749018 missense unknown
R1593:Ppig UTSW 2 69749081 missense unknown
R1629:Ppig UTSW 2 69735873 missense probably damaging 1.00
R1799:Ppig UTSW 2 69749400 missense unknown
R2001:Ppig UTSW 2 69741644 missense unknown
R2112:Ppig UTSW 2 69750107 missense unknown
R3702:Ppig UTSW 2 69733209 missense probably damaging 1.00
R3855:Ppig UTSW 2 69749375 missense unknown
R4999:Ppig UTSW 2 69741486 missense unknown
R5001:Ppig UTSW 2 69741486 missense unknown
R5153:Ppig UTSW 2 69749650 missense unknown
R5218:Ppig UTSW 2 69732783 intron probably benign
R5336:Ppig UTSW 2 69750224 missense unknown
R5410:Ppig UTSW 2 69735897 missense probably null 1.00
R5443:Ppig UTSW 2 69734291 missense probably damaging 1.00
R5513:Ppig UTSW 2 69750359 missense probably benign 0.23
R6179:Ppig UTSW 2 69750127 missense unknown
R6333:Ppig UTSW 2 69749558 missense unknown
R6932:Ppig UTSW 2 69732411 missense probably benign 0.40
R7206:Ppig UTSW 2 69741566 missense unknown
R7220:Ppig UTSW 2 69749976 missense unknown
R7308:Ppig UTSW 2 69749462 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAAGGCCTGACTGTTGTACTC -3'
(R):5'- GATCGTATGCCACTGTTATAAAACC -3'

Sequencing Primer
(F):5'- CTCTGAGTTGAGATGACTGAATGAAC -3'
(R):5'- AAACCTTTCTATTTCAGTGCTCTTAC -3'
Posted On2018-06-22