Incidental Mutation 'R6604:Slc12a1'
ID 525519
Institutional Source Beutler Lab
Gene Symbol Slc12a1
Ensembl Gene ENSMUSG00000027202
Gene Name solute carrier family 12, member 1
Synonyms urehr3, mBSC1, Nkcc2, D630042G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R6604 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 125152505-125230002 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 125184815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 457 (D457Y)
Ref Sequence ENSEMBL: ENSMUSP00000106121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000028630
AA Change: D457Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202
AA Change: D457Y

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 82 152 5.3e-22 PFAM
Pfam:AA_permease 173 677 2.3e-152 PFAM
Pfam:AA_permease_2 177 636 2.6e-24 PFAM
coiled coil region 815 843 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110494
AA Change: D457Y

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202
AA Change: D457Y

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 2.2e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110495
AA Change: D457Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202
AA Change: D457Y

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 1.6e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,439,579 probably benign Het
Abca13 T G 11: 9,378,384 F3486V probably damaging Het
Adcy9 A G 16: 4,304,407 L830P probably damaging Het
Aurkb T A 11: 69,048,562 L157* probably null Het
Bbs10 T G 10: 111,301,104 L693V possibly damaging Het
Dna2 G T 10: 62,967,743 probably null Het
Ext1 A G 15: 53,083,159 F550L probably damaging Het
Gm11639 T A 11: 104,698,946 L123* probably null Het
Gm13101 T C 4: 143,965,997 R145G probably benign Het
Gm5129 A G 5: 29,735,767 probably benign Het
Golm1 A G 13: 59,638,383 Y332H probably damaging Het
Gpbp1l1 C T 4: 116,573,505 P58S probably benign Het
Grk4 A T 5: 34,719,864 D301V probably damaging Het
Haus1 T C 18: 77,764,097 E106G probably damaging Het
Hpd T C 5: 123,180,901 probably null Het
Kcnj6 C A 16: 94,762,645 E313D probably damaging Het
Lmna A G 3: 88,488,282 V57A probably damaging Het
Lrrtm1 T C 6: 77,244,238 F226S possibly damaging Het
Otogl T C 10: 107,822,034 probably null Het
Pgr A C 9: 8,946,866 T703P possibly damaging Het
Ppig T C 2: 69,741,581 S215P unknown Het
Rasgrp3 A C 17: 75,503,115 N270T probably benign Het
Rp1 C A 1: 4,019,128 K1305N unknown Het
Shc1 A G 3: 89,421,879 Y10C probably damaging Het
Sncaip A G 18: 52,905,846 Q544R possibly damaging Het
Socs5 T C 17: 87,135,125 Y498H probably damaging Het
Szt2 T C 4: 118,385,474 D1472G probably benign Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmem236 A G 2: 14,174,701 T38A probably benign Het
Vmn2r29 A T 7: 7,231,859 V676E probably damaging Het
Vps13d A G 4: 145,181,124 V56A probably damaging Het
Xirp2 T C 2: 67,509,845 I810T possibly damaging Het
Zfp958 T C 8: 4,628,245 L90P probably damaging Het
Other mutations in Slc12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Slc12a1 APN 2 125188194 missense probably damaging 1.00
IGL00845:Slc12a1 APN 2 125188238 missense probably damaging 1.00
IGL01348:Slc12a1 APN 2 125194131 missense probably damaging 1.00
IGL01534:Slc12a1 APN 2 125217910 missense probably damaging 1.00
IGL01677:Slc12a1 APN 2 125178149 splice site probably benign
IGL02150:Slc12a1 APN 2 125184815 missense probably damaging 1.00
IGL02220:Slc12a1 APN 2 125188270 critical splice donor site probably null
IGL02568:Slc12a1 APN 2 125184728 missense probably damaging 1.00
IGL02602:Slc12a1 APN 2 125154242 missense probably damaging 1.00
IGL02625:Slc12a1 APN 2 125170691 missense probably damaging 1.00
IGL02635:Slc12a1 APN 2 125225978 missense probably benign
IGL02672:Slc12a1 APN 2 125170676 missense probably damaging 1.00
IGL02718:Slc12a1 APN 2 125161079 nonsense probably null
IGL03191:Slc12a1 APN 2 125206089 missense possibly damaging 0.87
FR4449:Slc12a1 UTSW 2 125154216 small insertion probably benign
FR4548:Slc12a1 UTSW 2 125154214 small insertion probably benign
FR4737:Slc12a1 UTSW 2 125154214 small insertion probably benign
PIT4431001:Slc12a1 UTSW 2 125190204 missense possibly damaging 0.78
R0033:Slc12a1 UTSW 2 125214009 missense probably benign
R0127:Slc12a1 UTSW 2 125219762 missense probably damaging 1.00
R0312:Slc12a1 UTSW 2 125226028 missense probably damaging 0.98
R0373:Slc12a1 UTSW 2 125226031 missense probably damaging 1.00
R0692:Slc12a1 UTSW 2 125194162 nonsense probably null
R1194:Slc12a1 UTSW 2 125184767 missense probably benign 0.00
R1264:Slc12a1 UTSW 2 125218238 missense possibly damaging 0.56
R1529:Slc12a1 UTSW 2 125190295 missense probably damaging 1.00
R1543:Slc12a1 UTSW 2 125184857 missense possibly damaging 0.93
R1940:Slc12a1 UTSW 2 125194193 missense probably benign 0.05
R2109:Slc12a1 UTSW 2 125173699 missense probably damaging 1.00
R2167:Slc12a1 UTSW 2 125173681 missense probably damaging 1.00
R3409:Slc12a1 UTSW 2 125154151 missense probably benign 0.00
R3902:Slc12a1 UTSW 2 125188193 missense probably damaging 1.00
R4079:Slc12a1 UTSW 2 125200623 missense possibly damaging 0.86
R4502:Slc12a1 UTSW 2 125226044 missense probably damaging 1.00
R4557:Slc12a1 UTSW 2 125186641 missense probably damaging 1.00
R4719:Slc12a1 UTSW 2 125153993 missense possibly damaging 0.82
R4782:Slc12a1 UTSW 2 125161079 nonsense probably null
R4845:Slc12a1 UTSW 2 125188226 missense probably damaging 1.00
R4913:Slc12a1 UTSW 2 125228750 missense probably damaging 0.96
R5024:Slc12a1 UTSW 2 125166137 missense probably benign 0.00
R5112:Slc12a1 UTSW 2 125218224 missense possibly damaging 0.63
R5334:Slc12a1 UTSW 2 125217889 missense probably damaging 1.00
R5470:Slc12a1 UTSW 2 125170714 missense probably damaging 1.00
R6057:Slc12a1 UTSW 2 125190213 missense probably damaging 1.00
R6941:Slc12a1 UTSW 2 125214079 missense possibly damaging 0.85
R6944:Slc12a1 UTSW 2 125160534 missense probably damaging 0.97
R7049:Slc12a1 UTSW 2 125171257 missense probably benign 0.04
R7204:Slc12a1 UTSW 2 125200622 missense possibly damaging 0.93
R7427:Slc12a1 UTSW 2 125214132 missense probably benign
R7428:Slc12a1 UTSW 2 125214132 missense probably benign
R7432:Slc12a1 UTSW 2 125206040 missense probably benign 0.36
R7470:Slc12a1 UTSW 2 125217895 nonsense probably null
R7828:Slc12a1 UTSW 2 125166682 missense possibly damaging 0.85
R7862:Slc12a1 UTSW 2 125161094 missense probably damaging 0.99
R7923:Slc12a1 UTSW 2 125214092 missense possibly damaging 0.75
R8020:Slc12a1 UTSW 2 125178102 missense possibly damaging 0.78
R8071:Slc12a1 UTSW 2 125186314 missense probably damaging 1.00
R8272:Slc12a1 UTSW 2 125228816 missense probably damaging 1.00
R8302:Slc12a1 UTSW 2 125190289 missense probably damaging 0.99
R8722:Slc12a1 UTSW 2 125160598 missense probably damaging 1.00
R9029:Slc12a1 UTSW 2 125154084 missense probably benign
R9153:Slc12a1 UTSW 2 125161069 splice site probably benign
R9449:Slc12a1 UTSW 2 125186224 missense probably damaging 1.00
R9568:Slc12a1 UTSW 2 125190298 missense probably damaging 1.00
R9614:Slc12a1 UTSW 2 125160525 missense probably damaging 0.99
R9723:Slc12a1 UTSW 2 125217907 missense probably damaging 1.00
RF032:Slc12a1 UTSW 2 125154210 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCTCTGTCAAAGGGATG -3'
(R):5'- ATTCTGAAAATGCAGACACCG -3'

Sequencing Primer
(F):5'- TCAGGGACTTAGCTCAGCG -3'
(R):5'- GCAGACACCGATAAACTCTATCTTTC -3'
Posted On 2018-06-22