Incidental Mutation 'R6637:Lrrc8b'
ID525520
Institutional Source Beutler Lab
Gene Symbol Lrrc8b
Ensembl Gene ENSMUSG00000070639
Gene Nameleucine rich repeat containing 8 family, member B
SynonymsR75581
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6637 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105415775-105490074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105480271 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 161 (D161A)
Ref Sequence ENSEMBL: ENSMUSP00000108327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112707]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112707
AA Change: D161A

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108327
Gene: ENSMUSG00000070639
AA Change: D161A

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 334 2.9e-133 PFAM
LRR 509 536 5.27e1 SMART
LRR 584 607 2.03e1 SMART
LRR 632 654 1.97e1 SMART
LRR_TYP 655 678 4.79e-3 SMART
LRR 679 700 3.09e1 SMART
LRR_TYP 701 724 4.17e-3 SMART
LRR 747 770 2.17e-1 SMART
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Adh1 T A 3: 138,282,470 C98* probably null Het
Alms1 A G 6: 85,619,734 H514R possibly damaging Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Col3a1 C T 1: 45,347,730 T234I probably damaging Het
Cxadr C T 16: 78,333,503 T186M possibly damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fbxo16 A G 14: 65,295,761 probably null Het
Fign A G 2: 64,027,908 probably benign Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Invs G A 4: 48,416,203 probably null Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Kcnk5 A C 14: 20,144,721 M183R probably null Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Lrriq1 A T 10: 103,221,432 F169Y probably benign Het
Lsamp T A 16: 41,533,381 V2D possibly damaging Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Olfr1095 T G 2: 86,851,440 K86T probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Spa17 A T 9: 37,611,974 S6T probably benign Het
Ston2 G C 12: 91,714,112 T126S probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tbr1 A G 2: 61,811,630 D150G probably benign Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Ubxn4 C A 1: 128,277,087 Q505K probably damaging Het
Vcl A G 14: 21,003,132 E405G probably damaging Het
Vmn2r26 A T 6: 124,061,691 I742F probably damaging Het
Other mutations in Lrrc8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Lrrc8b APN 5 105480499 missense probably damaging 0.96
IGL00519:Lrrc8b APN 5 105481725 missense possibly damaging 0.82
IGL01732:Lrrc8b APN 5 105485960 missense probably damaging 1.00
IGL01799:Lrrc8b APN 5 105485891 missense probably benign
IGL02005:Lrrc8b APN 5 105481054 missense probably benign 0.22
IGL02205:Lrrc8b APN 5 105481837 missense probably benign 0.07
IGL03038:Lrrc8b APN 5 105481492 missense probably damaging 0.98
IGL03076:Lrrc8b APN 5 105481549 missense probably damaging 1.00
IGL02796:Lrrc8b UTSW 5 105481345 missense probably damaging 1.00
R0647:Lrrc8b UTSW 5 105480607 missense possibly damaging 0.69
R0722:Lrrc8b UTSW 5 105480112 missense possibly damaging 0.89
R1382:Lrrc8b UTSW 5 105480883 missense probably damaging 1.00
R1437:Lrrc8b UTSW 5 105481702 missense probably damaging 1.00
R1801:Lrrc8b UTSW 5 105480823 missense probably damaging 1.00
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R2169:Lrrc8b UTSW 5 105481887 missense probably damaging 0.99
R4514:Lrrc8b UTSW 5 105479953 missense probably damaging 1.00
R4898:Lrrc8b UTSW 5 105480214 missense probably benign 0.19
R5243:Lrrc8b UTSW 5 105480946 missense probably damaging 1.00
R5264:Lrrc8b UTSW 5 105480252 missense probably damaging 0.98
R5424:Lrrc8b UTSW 5 105480703 missense probably damaging 1.00
R5513:Lrrc8b UTSW 5 105485984 missense probably damaging 1.00
R5632:Lrrc8b UTSW 5 105480297 missense possibly damaging 0.81
R5799:Lrrc8b UTSW 5 105481342 missense probably benign 0.19
R5800:Lrrc8b UTSW 5 105481342 missense probably benign 0.19
R7249:Lrrc8b UTSW 5 105481267 missense probably benign 0.23
R7253:Lrrc8b UTSW 5 105481656 missense probably benign 0.01
R7558:Lrrc8b UTSW 5 105481711 missense probably damaging 1.00
R8077:Lrrc8b UTSW 5 105480017 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCGATGCTGTCTGCTACGAG -3'
(R):5'- AAGATGGCCTTGGCTTGTTC -3'

Sequencing Primer
(F):5'- GAAACAGCTCCATTGGTTCG -3'
(R):5'- CTTCTTGTCCAGGACGCTAGAAG -3'
Posted On2018-06-22