Incidental Mutation 'R6604:Shc1'
ID 525523
Institutional Source Beutler Lab
Gene Symbol Shc1
Ensembl Gene ENSMUSG00000042626
Gene Name src homology 2 domain-containing transforming protein C1
Synonyms ShcA, p66shc, p66
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R6604 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 89418443-89430027 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89421879 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 10 (Y10C)
Ref Sequence ENSEMBL: ENSMUSP00000091940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029679] [ENSMUST00000039110] [ENSMUST00000094378] [ENSMUST00000107417] [ENSMUST00000107422] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000137793] [ENSMUST00000154791] [ENSMUST00000183484] [ENSMUST00000191485]
AlphaFold P98083
Predicted Effect probably benign
Transcript: ENSMUST00000029679
SMART Domains Protein: ENSMUSP00000029679
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
CKS 5 74 4.1e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039110
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094378
AA Change: Y10C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626
AA Change: Y10C

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107417
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107422
SMART Domains Protein: ENSMUSP00000103045
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
CKS 1 52 3.88e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125036
SMART Domains Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 1 155 1.5e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128238
SMART Domains Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 144 7.7e-19 PFAM
Pfam:PID 134 190 7.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137793
SMART Domains Protein: ENSMUSP00000117190
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153334
Predicted Effect probably benign
Transcript: ENSMUST00000154791
SMART Domains Protein: ENSMUSP00000123635
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 100 5.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183484
SMART Domains Protein: ENSMUSP00000138900
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
Pfam:CKS 5 36 2.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191485
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes with a targeted mutation of the exon encoding the CH2 region show an extended life span, reduced cellular sensitivity to oxidative stress and UV irradiation, and resistance to diet-induced atherogenesis. Homozygotes lacking all three isoformsdie around E11.5 with cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,439,579 probably benign Het
Abca13 T G 11: 9,378,384 F3486V probably damaging Het
Adcy9 A G 16: 4,304,407 L830P probably damaging Het
Aurkb T A 11: 69,048,562 L157* probably null Het
Bbs10 T G 10: 111,301,104 L693V possibly damaging Het
Dna2 G T 10: 62,967,743 probably null Het
Ext1 A G 15: 53,083,159 F550L probably damaging Het
Gm11639 T A 11: 104,698,946 L123* probably null Het
Gm13101 T C 4: 143,965,997 R145G probably benign Het
Gm5129 A G 5: 29,735,767 probably benign Het
Golm1 A G 13: 59,638,383 Y332H probably damaging Het
Gpbp1l1 C T 4: 116,573,505 P58S probably benign Het
Grk4 A T 5: 34,719,864 D301V probably damaging Het
Haus1 T C 18: 77,764,097 E106G probably damaging Het
Hpd T C 5: 123,180,901 probably null Het
Kcnj6 C A 16: 94,762,645 E313D probably damaging Het
Lmna A G 3: 88,488,282 V57A probably damaging Het
Lrrtm1 T C 6: 77,244,238 F226S possibly damaging Het
Otogl T C 10: 107,822,034 probably null Het
Pgr A C 9: 8,946,866 T703P possibly damaging Het
Ppig T C 2: 69,741,581 S215P unknown Het
Rasgrp3 A C 17: 75,503,115 N270T probably benign Het
Rp1 C A 1: 4,019,128 K1305N unknown Het
Slc12a1 G T 2: 125,184,815 D457Y probably damaging Het
Sncaip A G 18: 52,905,846 Q544R possibly damaging Het
Socs5 T C 17: 87,135,125 Y498H probably damaging Het
Szt2 T C 4: 118,385,474 D1472G probably benign Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmem236 A G 2: 14,174,701 T38A probably benign Het
Vmn2r29 A T 7: 7,231,859 V676E probably damaging Het
Vps13d A G 4: 145,181,124 V56A probably damaging Het
Xirp2 T C 2: 67,509,845 I810T possibly damaging Het
Zfp958 T C 8: 4,628,245 L90P probably damaging Het
Other mutations in Shc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Shc1 APN 3 89424229 missense probably damaging 0.99
IGL01608:Shc1 APN 3 89424849 missense probably damaging 0.96
IGL02710:Shc1 APN 3 89424610 splice site probably null
PIT4382001:Shc1 UTSW 3 89427408 missense probably benign 0.00
R0323:Shc1 UTSW 3 89423713 missense probably damaging 0.98
R0445:Shc1 UTSW 3 89426537 missense probably damaging 1.00
R0827:Shc1 UTSW 3 89426783 splice site probably null
R0833:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R0836:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R1155:Shc1 UTSW 3 89424819 missense probably benign 0.30
R1497:Shc1 UTSW 3 89428445 makesense probably null
R1929:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R2271:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R4402:Shc1 UTSW 3 89426678 missense probably benign
R4965:Shc1 UTSW 3 89426996 missense probably damaging 0.98
R5898:Shc1 UTSW 3 89426967 nonsense probably null
R6198:Shc1 UTSW 3 89422107 missense probably benign
R6673:Shc1 UTSW 3 89421962 missense possibly damaging 0.93
R6705:Shc1 UTSW 3 89422959 nonsense probably null
R7379:Shc1 UTSW 3 89426822 missense probably benign 0.00
R8041:Shc1 UTSW 3 89422953 missense probably damaging 1.00
R8284:Shc1 UTSW 3 89421908 missense possibly damaging 0.70
R8700:Shc1 UTSW 3 89427433 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTCTCAAACTGTCTAGGTCTGAG -3'
(R):5'- AGCTTCAGGTTGCTCATCCG -3'

Sequencing Primer
(F):5'- AGAGCAGAGGTCACTTGTCCTTC -3'
(R):5'- GTTGCTCATCCGGGGAAAG -3'
Posted On 2018-06-22