Incidental Mutation 'R6637:Spa17'
ID525534
Institutional Source Beutler Lab
Gene Symbol Spa17
Ensembl Gene ENSMUSG00000001948
Gene Namesperm autoantigenic protein 17
SynonymsSp17, band 34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6637 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37603290-37613722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37611974 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 6 (S6T)
Ref Sequence ENSEMBL: ENSMUSP00000002013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002013] [ENSMUST00000213126] [ENSMUST00000214786] [ENSMUST00000215474] [ENSMUST00000215829]
Predicted Effect probably benign
Transcript: ENSMUST00000002013
AA Change: S6T

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002013
Gene: ENSMUSG00000001948
AA Change: S6T

DomainStartEndE-ValueType
RIIa 14 51 7.04e-15 SMART
low complexity region 75 86 N/A INTRINSIC
IQ 111 133 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213126
Predicted Effect probably benign
Transcript: ENSMUST00000214786
AA Change: S6T

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215336
Predicted Effect probably benign
Transcript: ENSMUST00000215474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215678
Predicted Effect probably benign
Transcript: ENSMUST00000215829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217567
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein present at the cell surface. The N-terminus has sequence similarity to human cAMP-dependent protein kinase A (PKA) type II alpha regulatory subunit (RIIa) while the C-terminus has an IQ calmodulin-binding motif. The central portion of the protein has carbohydrate binding motifs and likely functions in cell-cell adhesion. The protein was initially characterized by its involvement in the binding of sperm to the zona pellucida of the oocyte. Recent studies indicate that it is also involved in additional cell-cell adhesion functions such as immune cell migration and metastasis. A retrotransposed pseudogene is present on chromosome 10q22.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Adh1 T A 3: 138,282,470 C98* probably null Het
Alms1 A G 6: 85,619,734 H514R possibly damaging Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Col3a1 C T 1: 45,347,730 T234I probably damaging Het
Cxadr C T 16: 78,333,503 T186M possibly damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fbxo16 A G 14: 65,295,761 probably null Het
Fign A G 2: 64,027,908 probably benign Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Invs G A 4: 48,416,203 probably null Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Kcnk5 A C 14: 20,144,721 M183R probably null Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Lrrc8b A C 5: 105,480,271 D161A possibly damaging Het
Lrriq1 A T 10: 103,221,432 F169Y probably benign Het
Lsamp T A 16: 41,533,381 V2D possibly damaging Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Olfr1095 T G 2: 86,851,440 K86T probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Ston2 G C 12: 91,714,112 T126S probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tbr1 A G 2: 61,811,630 D150G probably benign Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Ubxn4 C A 1: 128,277,087 Q505K probably damaging Het
Vcl A G 14: 21,003,132 E405G probably damaging Het
Vmn2r26 A T 6: 124,061,691 I742F probably damaging Het
Other mutations in Spa17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0575:Spa17 UTSW 9 37603393 missense probably damaging 0.99
R3789:Spa17 UTSW 9 37611845 missense possibly damaging 0.89
R5244:Spa17 UTSW 9 37611989 start codon destroyed probably damaging 1.00
R5503:Spa17 UTSW 9 37611977 missense probably damaging 1.00
R6612:Spa17 UTSW 9 37605794 missense probably benign 0.14
R6636:Spa17 UTSW 9 37611974 missense probably benign 0.45
R7233:Spa17 UTSW 9 37603291 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAGGCTGAAGACATGTATATTCC -3'
(R):5'- ACCAGGACCTAGATTGTGTGAC -3'

Sequencing Primer
(F):5'- GCTGAAGACATGTATATTCCTCAATC -3'
(R):5'- GAGAAATGATTTGAGTCGTG -3'
Posted On2018-06-22