Mutagenetix > Incidental Mutations

Incidental Mutation 'R6604:Lrrtm1'

525539

Institutional Source

Beutler Lab

Gene Symbol

Lrrtm1

Ensembl Gene

ENSMUSG00000060780

Gene Name

leucine rich repeat transmembrane neuronal 1

Synonyms

4632401D06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6604 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

77242689-77257791 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77244238 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 226 (F226S)

Ref Sequence

ENSEMBL: ENSMUSP00000124373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020400] [ENSMUST00000075340] [ENSMUST00000159616] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161677] [ENSMUST00000161811] [ENSMUST00000161846]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020400
AA Change: F226S

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000020400
Gene: ENSMUSG00000060780
AA Change: F226S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	38	70	1.06e0	SMART
LRR	64	87	5.56e0	SMART
LRR	88	111	1.03e1	SMART
LRR_TYP	112	135	2.71e-2	SMART
LRR_TYP	136	159	1.98e-4	SMART
LRR_TYP	160	183	9.44e-2	SMART
LRR	184	207	6.96e0	SMART
LRR	208	236	1.76e2	SMART
LRR	255	278	4.71e1	SMART
LRR	279	302	1.03e1	SMART
Blast:LRRCT	314	364	4e-13	BLAST
transmembrane domain	428	450	N/A	INTRINSIC
low complexity region	467	475	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075340

SMART Domains

Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063

Domain	Start	End	E-Value	Type
Pfam:Vinculin	18	337	2e-104	PFAM
Pfam:Vinculin	331	866	7.7e-222	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159616
AA Change: F226S

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000125207
Gene: ENSMUSG00000060780
AA Change: F226S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	38	70	1.06e0	SMART
LRR	64	87	5.56e0	SMART
LRR	88	111	1.03e1	SMART
LRR_TYP	112	135	2.71e-2	SMART
LRR_TYP	136	159	1.98e-4	SMART
LRR_TYP	160	183	9.44e-2	SMART
LRR	184	207	6.96e0	SMART
LRR	208	236	1.76e2	SMART
LRR	255	278	4.71e1	SMART
LRR	279	302	1.03e1	SMART
Blast:LRRCT	314	364	4e-13	BLAST
transmembrane domain	428	450	N/A	INTRINSIC
low complexity region	467	475	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159626

SMART Domains

Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063

Domain	Start	End	E-Value	Type
Pfam:Vinculin	18	337	3.4e-105	PFAM
Pfam:Vinculin	330	914	6.6e-214	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160894

SMART Domains

Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063

Domain	Start	End	E-Value	Type
Pfam:Vinculin	31	352	2.1e-104	PFAM
Pfam:Vinculin	343	927	4.6e-213	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161677
AA Change: F226S

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124373
Gene: ENSMUSG00000060780
AA Change: F226S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	38	70	1.06e0	SMART
LRR	64	87	5.56e0	SMART
LRR	88	111	1.03e1	SMART
LRR_TYP	112	135	2.71e-2	SMART
LRR_TYP	136	159	1.98e-4	SMART
LRR_TYP	160	183	9.44e-2	SMART
LRR	184	207	6.96e0	SMART
LRR	208	236	1.76e2	SMART
LRR	255	278	4.71e1	SMART
LRR	279	302	1.03e1	SMART
Blast:LRRCT	314	364	4e-13	BLAST
transmembrane domain	428	450	N/A	INTRINSIC
low complexity region	467	475	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161811

SMART Domains

Protein: ENSMUSP00000124948
Gene: ENSMUSG00000060780

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	38	70	1.06e0	SMART
LRR	64	87	5.56e0	SMART
LRR	88	111	1.03e1	SMART
LRR_TYP	112	135	2.71e-2	SMART
LRR_TYP	136	159	1.98e-4	SMART
LRR_TYP	160	183	9.44e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161846

SMART Domains

Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063

Domain	Start	End	E-Value	Type
Pfam:Vinculin	31	350	5.3e-105	PFAM
Pfam:Vinculin	344	879	2.1e-222	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with grossly normal brain morphology. Mice homozygous for another knock-out allele exhibit impaired cognitive function and altered hippocampal synapse morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	A	G	15: 37,439,579		probably benign	Het
Abca13	T	G	11: 9,378,384	F3486V	probably damaging	Het
Adcy9	A	G	16: 4,304,407	L830P	probably damaging	Het
Aurkb	T	A	11: 69,048,562	L157*	probably null	Het
Bbs10	T	G	10: 111,301,104	L693V	possibly damaging	Het
Dna2	G	T	10: 62,967,743		probably null	Het
Ext1	A	G	15: 53,083,159	F550L	probably damaging	Het
Gm11639	T	A	11: 104,698,946	L123*	probably null	Het
Gm13101	T	C	4: 143,965,997	R145G	probably benign	Het
Gm5129	A	G	5: 29,735,767		probably benign	Het
Golm1	A	G	13: 59,638,383	Y332H	probably damaging	Het
Gpbp1l1	C	T	4: 116,573,505	P58S	probably benign	Het
Grk4	A	T	5: 34,719,864	D301V	probably damaging	Het
Haus1	T	C	18: 77,764,097	E106G	probably damaging	Het
Hpd	T	C	5: 123,180,901		probably null	Het
Kcnj6	C	A	16: 94,762,645	E313D	probably damaging	Het
Lmna	A	G	3: 88,488,282	V57A	probably damaging	Het
Otogl	T	C	10: 107,822,034		probably null	Het
Pgr	A	C	9: 8,946,866	T703P	possibly damaging	Het
Ppig	T	C	2: 69,741,581	S215P	unknown	Het
Rasgrp3	A	C	17: 75,503,115	N270T	probably benign	Het
Rp1	C	A	1: 4,019,128	K1305N	unknown	Het
Shc1	A	G	3: 89,421,879	Y10C	probably damaging	Het
Slc12a1	G	T	2: 125,184,815	D457Y	probably damaging	Het
Sncaip	A	G	18: 52,905,846	Q544R	possibly damaging	Het
Socs5	T	C	17: 87,135,125	Y498H	probably damaging	Het
Szt2	T	C	4: 118,385,474	D1472G	probably benign	Het
Tmem163	A	G	1: 127,491,610	M286T	possibly damaging	Het
Tmem236	A	G	2: 14,174,701	T38A	probably benign	Het
Vmn2r29	A	T	7: 7,231,859	V676E	probably damaging	Het
Vps13d	A	G	4: 145,181,124	V56A	probably damaging	Het
Xirp2	T	C	2: 67,509,845	I810T	possibly damaging	Het
Zfp958	T	C	8: 4,628,245	L90P	probably damaging	Het

Other mutations in Lrrtm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Lrrtm1	APN	6	77244063	missense	probably benign	0.00
IGL01011:Lrrtm1	APN	6	77244235	unclassified	probably null
IGL01125:Lrrtm1	APN	6	77244453	missense	probably damaging	1.00
IGL01924:Lrrtm1	APN	6	77244186	missense	possibly damaging	0.81
IGL02508:Lrrtm1	APN	6	77244591	missense	probably damaging	1.00
IGL03005:Lrrtm1	APN	6	77244156	missense	probably damaging	1.00
IGL03076:Lrrtm1	APN	6	77244585	missense	probably damaging	1.00
R0077:Lrrtm1	UTSW	6	77243872	missense	probably damaging	1.00
R0540:Lrrtm1	UTSW	6	77244628	missense	probably damaging	1.00
R0607:Lrrtm1	UTSW	6	77244628	missense	probably damaging	1.00
R0927:Lrrtm1	UTSW	6	77244860	missense	probably damaging	1.00
R1742:Lrrtm1	UTSW	6	77244091	missense	probably damaging	1.00
R1762:Lrrtm1	UTSW	6	77244697	missense	probably benign
R1933:Lrrtm1	UTSW	6	77244966	intron	probably null
R1934:Lrrtm1	UTSW	6	77244966	intron	probably null
R2180:Lrrtm1	UTSW	6	77244346	missense	probably damaging	1.00
R2267:Lrrtm1	UTSW	6	77244013	missense	probably damaging	0.97
R2914:Lrrtm1	UTSW	6	77244979	missense	probably damaging	0.99
R2937:Lrrtm1	UTSW	6	77243652	missense	probably benign	0.03
R2938:Lrrtm1	UTSW	6	77243652	missense	probably benign	0.03
R4604:Lrrtm1	UTSW	6	77244144	missense	probably damaging	1.00
R4908:Lrrtm1	UTSW	6	77244678	missense	probably benign	0.01
R4910:Lrrtm1	UTSW	6	77244901	missense	probably damaging	1.00
R5739:Lrrtm1	UTSW	6	77244889	missense	probably damaging	0.99
R6845:Lrrtm1	UTSW	6	77243881	missense	probably benign	0.02
R7048:Lrrtm1	UTSW	6	77244169	missense	probably damaging	1.00
R7203:Lrrtm1	UTSW	6	77243601	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATGCCATCCAATTCGTGC -3'
(R):5'- TTCCAGGAGTTGAGAATACGG -3'

Sequencing Primer
(F):5'- ATCCAATTCGTGCCGGTG -3'
(R):5'- TTGGAGTCCAGCTGCAGG -3'

Posted On

2018-06-22