Incidental Mutation 'R6604:Lrrtm1'
ID525539
Institutional Source Beutler Lab
Gene Symbol Lrrtm1
Ensembl Gene ENSMUSG00000060780
Gene Nameleucine rich repeat transmembrane neuronal 1
Synonyms4632401D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6604 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location77242689-77257791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77244238 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 226 (F226S)
Ref Sequence ENSEMBL: ENSMUSP00000124373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020400] [ENSMUST00000075340] [ENSMUST00000159616] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161677] [ENSMUST00000161811] [ENSMUST00000161846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020400
AA Change: F226S

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020400
Gene: ENSMUSG00000060780
AA Change: F226S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075340
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159616
AA Change: F226S

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125207
Gene: ENSMUSG00000060780
AA Change: F226S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159626
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160894
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161677
AA Change: F226S

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124373
Gene: ENSMUSG00000060780
AA Change: F226S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161811
SMART Domains Protein: ENSMUSP00000124948
Gene: ENSMUSG00000060780

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161846
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with grossly normal brain morphology. Mice homozygous for another knock-out allele exhibit impaired cognitive function and altered hippocampal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,439,579 probably benign Het
Abca13 T G 11: 9,378,384 F3486V probably damaging Het
Adcy9 A G 16: 4,304,407 L830P probably damaging Het
Aurkb T A 11: 69,048,562 L157* probably null Het
Bbs10 T G 10: 111,301,104 L693V possibly damaging Het
Dna2 G T 10: 62,967,743 probably null Het
Ext1 A G 15: 53,083,159 F550L probably damaging Het
Gm11639 T A 11: 104,698,946 L123* probably null Het
Gm13101 T C 4: 143,965,997 R145G probably benign Het
Gm5129 A G 5: 29,735,767 probably benign Het
Golm1 A G 13: 59,638,383 Y332H probably damaging Het
Gpbp1l1 C T 4: 116,573,505 P58S probably benign Het
Grk4 A T 5: 34,719,864 D301V probably damaging Het
Haus1 T C 18: 77,764,097 E106G probably damaging Het
Hpd T C 5: 123,180,901 probably null Het
Kcnj6 C A 16: 94,762,645 E313D probably damaging Het
Lmna A G 3: 88,488,282 V57A probably damaging Het
Otogl T C 10: 107,822,034 probably null Het
Pgr A C 9: 8,946,866 T703P possibly damaging Het
Ppig T C 2: 69,741,581 S215P unknown Het
Rasgrp3 A C 17: 75,503,115 N270T probably benign Het
Rp1 C A 1: 4,019,128 K1305N unknown Het
Shc1 A G 3: 89,421,879 Y10C probably damaging Het
Slc12a1 G T 2: 125,184,815 D457Y probably damaging Het
Sncaip A G 18: 52,905,846 Q544R possibly damaging Het
Socs5 T C 17: 87,135,125 Y498H probably damaging Het
Szt2 T C 4: 118,385,474 D1472G probably benign Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmem236 A G 2: 14,174,701 T38A probably benign Het
Vmn2r29 A T 7: 7,231,859 V676E probably damaging Het
Vps13d A G 4: 145,181,124 V56A probably damaging Het
Xirp2 T C 2: 67,509,845 I810T possibly damaging Het
Zfp958 T C 8: 4,628,245 L90P probably damaging Het
Other mutations in Lrrtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Lrrtm1 APN 6 77244063 missense probably benign 0.00
IGL01011:Lrrtm1 APN 6 77244235 unclassified probably null
IGL01125:Lrrtm1 APN 6 77244453 missense probably damaging 1.00
IGL01924:Lrrtm1 APN 6 77244186 missense possibly damaging 0.81
IGL02508:Lrrtm1 APN 6 77244591 missense probably damaging 1.00
IGL03005:Lrrtm1 APN 6 77244156 missense probably damaging 1.00
IGL03076:Lrrtm1 APN 6 77244585 missense probably damaging 1.00
R0077:Lrrtm1 UTSW 6 77243872 missense probably damaging 1.00
R0540:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0607:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0927:Lrrtm1 UTSW 6 77244860 missense probably damaging 1.00
R1742:Lrrtm1 UTSW 6 77244091 missense probably damaging 1.00
R1762:Lrrtm1 UTSW 6 77244697 missense probably benign
R1933:Lrrtm1 UTSW 6 77244966 intron probably null
R1934:Lrrtm1 UTSW 6 77244966 intron probably null
R2180:Lrrtm1 UTSW 6 77244346 missense probably damaging 1.00
R2267:Lrrtm1 UTSW 6 77244013 missense probably damaging 0.97
R2914:Lrrtm1 UTSW 6 77244979 missense probably damaging 0.99
R2937:Lrrtm1 UTSW 6 77243652 missense probably benign 0.03
R2938:Lrrtm1 UTSW 6 77243652 missense probably benign 0.03
R4604:Lrrtm1 UTSW 6 77244144 missense probably damaging 1.00
R4908:Lrrtm1 UTSW 6 77244678 missense probably benign 0.01
R4910:Lrrtm1 UTSW 6 77244901 missense probably damaging 1.00
R5739:Lrrtm1 UTSW 6 77244889 missense probably damaging 0.99
R6845:Lrrtm1 UTSW 6 77243881 missense probably benign 0.02
R7048:Lrrtm1 UTSW 6 77244169 missense probably damaging 1.00
R7203:Lrrtm1 UTSW 6 77243601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGCCATCCAATTCGTGC -3'
(R):5'- TTCCAGGAGTTGAGAATACGG -3'

Sequencing Primer
(F):5'- ATCCAATTCGTGCCGGTG -3'
(R):5'- TTGGAGTCCAGCTGCAGG -3'
Posted On2018-06-22