Incidental Mutation 'R6604:Gm11639'
ID 525555
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Name predicted gene 11639
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock # R6604 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 104685707-105117394 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 104698946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 123 (L123*)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000148007
AA Change: L123*
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: L123*

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000212287
AA Change: L123*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,439,579 probably benign Het
Abca13 T G 11: 9,378,384 F3486V probably damaging Het
Adcy9 A G 16: 4,304,407 L830P probably damaging Het
Aurkb T A 11: 69,048,562 L157* probably null Het
Bbs10 T G 10: 111,301,104 L693V possibly damaging Het
Dna2 G T 10: 62,967,743 probably null Het
Ext1 A G 15: 53,083,159 F550L probably damaging Het
Gm13101 T C 4: 143,965,997 R145G probably benign Het
Gm5129 A G 5: 29,735,767 probably benign Het
Golm1 A G 13: 59,638,383 Y332H probably damaging Het
Gpbp1l1 C T 4: 116,573,505 P58S probably benign Het
Grk4 A T 5: 34,719,864 D301V probably damaging Het
Haus1 T C 18: 77,764,097 E106G probably damaging Het
Hpd T C 5: 123,180,901 probably null Het
Kcnj6 C A 16: 94,762,645 E313D probably damaging Het
Lmna A G 3: 88,488,282 V57A probably damaging Het
Lrrtm1 T C 6: 77,244,238 F226S possibly damaging Het
Otogl T C 10: 107,822,034 probably null Het
Pgr A C 9: 8,946,866 T703P possibly damaging Het
Ppig T C 2: 69,741,581 S215P unknown Het
Rasgrp3 A C 17: 75,503,115 N270T probably benign Het
Rp1 C A 1: 4,019,128 K1305N unknown Het
Shc1 A G 3: 89,421,879 Y10C probably damaging Het
Slc12a1 G T 2: 125,184,815 D457Y probably damaging Het
Sncaip A G 18: 52,905,846 Q544R possibly damaging Het
Socs5 T C 17: 87,135,125 Y498H probably damaging Het
Szt2 T C 4: 118,385,474 D1472G probably benign Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmem236 A G 2: 14,174,701 T38A probably benign Het
Vmn2r29 A T 7: 7,231,859 V676E probably damaging Het
Vps13d A G 4: 145,181,124 V56A probably damaging Het
Xirp2 T C 2: 67,509,845 I810T possibly damaging Het
Zfp958 T C 8: 4,628,245 L90P probably damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 splice site probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 splice site probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
R7620:Gm11639 UTSW 11 104832143 missense possibly damaging 0.95
R7638:Gm11639 UTSW 11 105036799 missense probably benign 0.03
R7661:Gm11639 UTSW 11 104726677 missense probably benign 0.03
R7667:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R7682:Gm11639 UTSW 11 104964348 splice site probably null
R7708:Gm11639 UTSW 11 104964571 missense unknown
R7721:Gm11639 UTSW 11 104724540 nonsense probably null
R7747:Gm11639 UTSW 11 104842603 missense probably damaging 0.96
R7840:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7846:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7893:Gm11639 UTSW 11 104979360 missense unknown
R7897:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R7936:Gm11639 UTSW 11 104999698 missense possibly damaging 0.89
R7936:Gm11639 UTSW 11 105046559 critical splice donor site probably null
R7959:Gm11639 UTSW 11 105042801 missense probably damaging 0.96
R8031:Gm11639 UTSW 11 104881469 missense possibly damaging 0.49
R8041:Gm11639 UTSW 11 104919479 missense unknown
R8054:Gm11639 UTSW 11 104730400 missense probably benign 0.07
R8056:Gm11639 UTSW 11 104909070 missense probably damaging 0.98
R8088:Gm11639 UTSW 11 104998246 missense probably benign 0.10
R8112:Gm11639 UTSW 11 104950200 missense unknown
R8340:Gm11639 UTSW 11 104986030 missense unknown
R8405:Gm11639 UTSW 11 104721198 missense probably benign 0.02
R8413:Gm11639 UTSW 11 104920309 missense unknown
R8472:Gm11639 UTSW 11 104818637 missense probably benign 0.07
R8549:Gm11639 UTSW 11 104999695 missense probably damaging 0.99
R8699:Gm11639 UTSW 11 104781246 missense probably benign 0.03
R8711:Gm11639 UTSW 11 104852545 missense probably benign 0.03
R8732:Gm11639 UTSW 11 104804274 missense probably benign 0.03
R8745:Gm11639 UTSW 11 104858478 missense possibly damaging 0.57
R8806:Gm11639 UTSW 11 105037869 missense probably benign 0.07
R8810:Gm11639 UTSW 11 104914895 missense unknown
R8845:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R8870:Gm11639 UTSW 11 104900674 missense probably benign 0.07
R8872:Gm11639 UTSW 11 104870054 missense probably benign 0.19
R8879:Gm11639 UTSW 11 104690955 missense probably benign 0.03
R8924:Gm11639 UTSW 11 104915427 frame shift probably null
R8954:Gm11639 UTSW 11 105018699 critical splice donor site probably null
R8960:Gm11639 UTSW 11 104929946 splice site probably benign
R8975:Gm11639 UTSW 11 105063589 missense probably benign 0.17
R8988:Gm11639 UTSW 11 105020526 missense probably benign 0.07
R8998:Gm11639 UTSW 11 104749651 missense probably benign 0.09
R8999:Gm11639 UTSW 11 104749651 missense probably benign 0.09
R9002:Gm11639 UTSW 11 105029996 missense probably damaging 0.99
R9012:Gm11639 UTSW 11 104820521 critical splice donor site probably null
R9036:Gm11639 UTSW 11 105036775 missense probably benign 0.03
R9037:Gm11639 UTSW 11 104912965 missense unknown
R9059:Gm11639 UTSW 11 104751863 missense possibly damaging 0.73
R9066:Gm11639 UTSW 11 104740862 intron probably benign
R9122:Gm11639 UTSW 11 104965779 missense unknown
R9125:Gm11639 UTSW 11 104845534 missense probably damaging 1.00
R9127:Gm11639 UTSW 11 104850581 missense probably benign 0.07
R9171:Gm11639 UTSW 11 104909882 missense probably benign 0.36
R9219:Gm11639 UTSW 11 104945865 missense unknown
R9224:Gm11639 UTSW 11 104770975 missense probably benign 0.07
R9235:Gm11639 UTSW 11 105017161 missense probably benign 0.19
R9294:Gm11639 UTSW 11 104831300 missense probably benign 0.24
R9318:Gm11639 UTSW 11 104965822 critical splice donor site probably null
R9322:Gm11639 UTSW 11 104874373 missense probably benign 0.36
R9361:Gm11639 UTSW 11 105005698 missense probably benign 0.03
R9408:Gm11639 UTSW 11 104730429 critical splice donor site probably null
R9434:Gm11639 UTSW 11 105009037 missense probably benign 0.24
R9477:Gm11639 UTSW 11 104945872 missense unknown
R9658:Gm11639 UTSW 11 104720294 missense probably benign 0.03
R9719:Gm11639 UTSW 11 104977086 missense unknown
R9751:Gm11639 UTSW 11 104893085 missense probably benign 0.19
R9763:Gm11639 UTSW 11 104999659 missense possibly damaging 0.89
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Z1176:Gm11639 UTSW 11 105001967 missense probably benign 0.29
Z1177:Gm11639 UTSW 11 104739338 nonsense probably null
Z1177:Gm11639 UTSW 11 104820518 missense probably benign 0.03
Z1177:Gm11639 UTSW 11 104924019 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTTATAGCAGGAACATGGCTAAG -3'
(R):5'- GTCAATAGGATACAATCTAAGTCCTCC -3'

Sequencing Primer
(F):5'- GCCAGATGCTGTGGTATGGTTATC -3'
(R):5'- ATAAAGTATTTCTGCCTCTGCCCAGG -3'
Posted On 2018-06-22