Mutagenetix > Incidental Mutations

Incidental Mutation 'R6604:Gm11639'

525555

Institutional Source

Beutler Lab

Gene Symbol

Gm11639

Ensembl Gene

ENSMUSG00000040838

Gene Name

predicted gene 11639

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R6604 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104685707-105117394 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 104698946 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 123 (L123*)

Ref Sequence

ENSEMBL: ENSMUSP00000148433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]

Predicted Effect

probably null
Transcript: ENSMUST00000148007
AA Change: L123*

SMART Domains

Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: L123*

Domain	Start	End	E-Value	Type
low complexity region	40	55	N/A	INTRINSIC
low complexity region	116	129	N/A	INTRINSIC
internal_repeat_4	146	233	3.42e-6	PROSPERO
internal_repeat_3	165	247	2.21e-6	PROSPERO
low complexity region	331	348	N/A	INTRINSIC
internal_repeat_2	349	361	4.38e-8	PROSPERO
internal_repeat_2	371	383	4.38e-8	PROSPERO
low complexity region	385	640	N/A	INTRINSIC
Pfam:EF-hand_8	677	729	8.7e-6	PFAM
low complexity region	835	842	N/A	INTRINSIC
internal_repeat_1	879	1106	2.47e-14	PROSPERO
internal_repeat_4	1015	1108	3.42e-6	PROSPERO

Predicted Effect

probably null
Transcript: ENSMUST00000212287
AA Change: L123*

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	A	G	15: 37,439,579		probably benign	Het
Abca13	T	G	11: 9,378,384	F3486V	probably damaging	Het
Adcy9	A	G	16: 4,304,407	L830P	probably damaging	Het
Aurkb	T	A	11: 69,048,562	L157*	probably null	Het
Bbs10	T	G	10: 111,301,104	L693V	possibly damaging	Het
Dna2	G	T	10: 62,967,743		probably null	Het
Ext1	A	G	15: 53,083,159	F550L	probably damaging	Het
Gm13101	T	C	4: 143,965,997	R145G	probably benign	Het
Gm5129	A	G	5: 29,735,767		probably benign	Het
Golm1	A	G	13: 59,638,383	Y332H	probably damaging	Het
Gpbp1l1	C	T	4: 116,573,505	P58S	probably benign	Het
Grk4	A	T	5: 34,719,864	D301V	probably damaging	Het
Haus1	T	C	18: 77,764,097	E106G	probably damaging	Het
Hpd	T	C	5: 123,180,901		probably null	Het
Kcnj6	C	A	16: 94,762,645	E313D	probably damaging	Het
Lmna	A	G	3: 88,488,282	V57A	probably damaging	Het
Lrrtm1	T	C	6: 77,244,238	F226S	possibly damaging	Het
Otogl	T	C	10: 107,822,034		probably null	Het
Pgr	A	C	9: 8,946,866	T703P	possibly damaging	Het
Ppig	T	C	2: 69,741,581	S215P	unknown	Het
Rasgrp3	A	C	17: 75,503,115	N270T	probably benign	Het
Rp1	C	A	1: 4,019,128	K1305N	unknown	Het
Shc1	A	G	3: 89,421,879	Y10C	probably damaging	Het
Slc12a1	G	T	2: 125,184,815	D457Y	probably damaging	Het
Sncaip	A	G	18: 52,905,846	Q544R	possibly damaging	Het
Socs5	T	C	17: 87,135,125	Y498H	probably damaging	Het
Szt2	T	C	4: 118,385,474	D1472G	probably benign	Het
Tmem163	A	G	1: 127,491,610	M286T	possibly damaging	Het
Tmem236	A	G	2: 14,174,701	T38A	probably benign	Het
Vmn2r29	A	T	7: 7,231,859	V676E	probably damaging	Het
Vps13d	A	G	4: 145,181,124	V56A	probably damaging	Het
Xirp2	T	C	2: 67,509,845	I810T	possibly damaging	Het
Zfp958	T	C	8: 4,628,245	L90P	probably damaging	Het

Other mutations in Gm11639

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Gm11639	APN	11	105100021	missense	probably damaging	1.00
IGL01308:Gm11639	APN	11	104720697	missense	probably benign	0.03
IGL01483:Gm11639	APN	11	104739347	missense	probably benign	0.03
IGL01695:Gm11639	APN	11	104736063	missense	probably damaging	1.00
IGL01860:Gm11639	APN	11	104690921	missense	probably benign	0.16
IGL01981:Gm11639	APN	11	104721432	intron	probably benign
IGL01984:Gm11639	APN	11	104738308	missense	probably benign	0.20
IGL02023:Gm11639	APN	11	104721432	intron	probably benign
IGL02252:Gm11639	APN	11	104753927	missense	possibly damaging	0.68
IGL02886:Gm11639	APN	11	105095874	missense	possibly damaging	0.95
IGL03116:Gm11639	APN	11	104721533	missense	probably benign	0.02
IGL03141:Gm11639	APN	11	105095870	missense	probably damaging	0.99
IGL03242:Gm11639	APN	11	105106404	missense	probably damaging	1.00
IGL03274:Gm11639	APN	11	104721093	missense	probably benign	0.03
IGL03408:Gm11639	APN	11	104710621	missense	probably benign	0.03
R0018:Gm11639	UTSW	11	104721552	critical splice donor site	probably null
R0068:Gm11639	UTSW	11	104720822	missense	probably benign	0.29
R0350:Gm11639	UTSW	11	104690880	missense	probably benign	0.03
R0646:Gm11639	UTSW	11	104720501	missense	probably benign	0.03
R0668:Gm11639	UTSW	11	104720492	missense	probably benign	0.16
R0715:Gm11639	UTSW	11	104720880	missense	possibly damaging	0.90
R0944:Gm11639	UTSW	11	104710730	splice site	probably null
R1330:Gm11639	UTSW	11	104746290	missense	possibly damaging	0.84
R1508:Gm11639	UTSW	11	104710677	missense	probably benign	0.03
R1643:Gm11639	UTSW	11	104698978	missense	probably benign	0.16
R1651:Gm11639	UTSW	11	104720666	missense	probably benign	0.03
R1665:Gm11639	UTSW	11	104721114	missense	probably benign	0.07
R1702:Gm11639	UTSW	11	104691006	missense	probably benign	0.03
R1711:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1779:Gm11639	UTSW	11	104720939	missense	probably benign	0.15
R1813:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1818:Gm11639	UTSW	11	104721507	missense	probably benign	0.10
R1896:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1969:Gm11639	UTSW	11	104746264	missense	probably damaging	1.00
R2139:Gm11639	UTSW	11	104751911	missense	possibly damaging	0.53
R2165:Gm11639	UTSW	11	104751862	missense	possibly damaging	0.93
R2359:Gm11639	UTSW	11	104739280	missense	possibly damaging	0.80
R2394:Gm11639	UTSW	11	104738295	missense	probably benign	0.17
R2406:Gm11639	UTSW	11	104720631	missense	probably benign	0.03
R2570:Gm11639	UTSW	11	104733664	missense	probably damaging	1.00
R3795:Gm11639	UTSW	11	104733675	missense	possibly damaging	0.94
R4352:Gm11639	UTSW	11	104739314	missense	probably null	0.25
R4359:Gm11639	UTSW	11	104733721	splice site	probably null
R4424:Gm11639	UTSW	11	104736114	critical splice donor site	probably null
R4895:Gm11639	UTSW	11	104720286	missense	probably benign	0.16
R4895:Gm11639	UTSW	11	104749670	missense	probably damaging	1.00
R5006:Gm11639	UTSW	11	104729677	splice site	probably null
R5066:Gm11639	UTSW	11	104720664	missense	probably benign	0.03
R5329:Gm11639	UTSW	11	104753806	intron	probably null
R5405:Gm11639	UTSW	11	104721192	missense	probably benign	0.07
R5814:Gm11639	UTSW	11	104736114	critical splice donor site	probably benign
R5888:Gm11639	UTSW	11	104721401	splice site	probably benign
R5910:Gm11639	UTSW	11	104690934	missense	probably benign	0.01
R5975:Gm11639	UTSW	11	104687549	start gained	probably benign
R6019:Gm11639	UTSW	11	105042902	critical splice donor site	probably null
R6028:Gm11639	UTSW	11	104769655	critical splice donor site	probably null
R6048:Gm11639	UTSW	11	104944433	missense	unknown
R6059:Gm11639	UTSW	11	105036769	missense	probably benign	0.03
R6147:Gm11639	UTSW	11	104967740	missense	unknown
R6176:Gm11639	UTSW	11	104792557	missense	probably benign	0.16
R6181:Gm11639	UTSW	11	104831333	missense	probably benign	0.25
R6196:Gm11639	UTSW	11	104855560	missense	probably benign	0.07
R6245:Gm11639	UTSW	11	104785008	missense	probably benign	0.03
R6262:Gm11639	UTSW	11	104893753	missense	probably benign	0.24
R6263:Gm11639	UTSW	11	104919486	missense	unknown
R6277:Gm11639	UTSW	11	105010322	missense	possibly damaging	0.49
R6338:Gm11639	UTSW	11	104843208	nonsense	probably null
R6355:Gm11639	UTSW	11	105005685	missense	probably benign	0.29
R6356:Gm11639	UTSW	11	104893707	missense	probably benign	0.19
R6365:Gm11639	UTSW	11	104924586	missense	unknown
R6391:Gm11639	UTSW	11	104994317	missense	possibly damaging	0.92
R6556:Gm11639	UTSW	11	105008251	missense	probably null	0.03
R6605:Gm11639	UTSW	11	104999281	splice site	probably null
R6634:Gm11639	UTSW	11	104893783	missense	probably benign	0.17
R6851:Gm11639	UTSW	11	105005695	missense	probably benign	0.03
R6862:Gm11639	UTSW	11	104721458	nonsense	probably null
R6949:Gm11639	UTSW	11	104909070	missense	probably damaging	1.00
R6970:Gm11639	UTSW	11	104776356	missense	probably benign	0.03
R7014:Gm11639	UTSW	11	104693422	missense	probably benign	0.03
R7097:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7122:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7124:Gm11639	UTSW	11	104738274	missense	probably benign	0.17
R7146:Gm11639	UTSW	11	104967752	missense	unknown
R7146:Gm11639	UTSW	11	105022938	missense	probably benign	0.03
R7154:Gm11639	UTSW	11	104699140	intron	probably null
R7175:Gm11639	UTSW	11	104947411	missense	unknown
R7198:Gm11639	UTSW	11	104751885	missense	probably benign	0.15
R7211:Gm11639	UTSW	11	104710713	missense	probably benign	0.01
R7211:Gm11639	UTSW	11	104724609	critical splice donor site	probably null
R7216:Gm11639	UTSW	11	104880549	missense	possibly damaging	0.49
R7221:Gm11639	UTSW	11	104900606	missense	probably benign	0.36
R7233:Gm11639	UTSW	11	104839843	missense	possibly damaging	0.69
R7236:Gm11639	UTSW	11	104899267	missense	probably benign	0.10
R7262:Gm11639	UTSW	11	104854606	critical splice donor site	probably null
R7289:Gm11639	UTSW	11	105038358	missense	probably benign	0.24
R7323:Gm11639	UTSW	11	105030011	missense	probably benign	0.07
R7378:Gm11639	UTSW	11	104714702	missense	probably benign	0.03
R7388:Gm11639	UTSW	11	104721045	missense	probably damaging	0.97
R7390:Gm11639	UTSW	11	104724585	missense	possibly damaging	0.46
R7411:Gm11639	UTSW	11	104999723	missense	probably benign	0.10
R7468:Gm11639	UTSW	11	104749700	missense	probably benign	0.17
R7497:Gm11639	UTSW	11	104762690	critical splice donor site	probably null
R7620:Gm11639	UTSW	11	104832143	missense	possibly damaging	0.95
R7638:Gm11639	UTSW	11	105036799	missense	probably benign	0.03
R7661:Gm11639	UTSW	11	104726677	missense	probably benign	0.03
R7667:Gm11639	UTSW	11	104751911	missense	possibly damaging	0.53
R7708:Gm11639	UTSW	11	104964571	missense	unknown
R7721:Gm11639	UTSW	11	104724540	nonsense	probably null
R7747:Gm11639	UTSW	11	104842603	missense	probably damaging	0.96
X0026:Gm11639	UTSW	11	104720975	missense	probably benign	0.07
Z1088:Gm11639	UTSW	11	104751902	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCTTTATAGCAGGAACATGGCTAAG -3'
(R):5'- GTCAATAGGATACAATCTAAGTCCTCC -3'

Sequencing Primer
(F):5'- GCCAGATGCTGTGGTATGGTTATC -3'
(R):5'- ATAAAGTATTTCTGCCTCTGCCCAGG -3'

Posted On

2018-06-22