Incidental Mutation 'R6638:Wdsub1'
ID525568
Institutional Source Beutler Lab
Gene Symbol Wdsub1
Ensembl Gene ENSMUSG00000026988
Gene NameWD repeat, SAM and U-box domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6638 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location59852364-59882591 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 59870441 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028368] [ENSMUST00000102751] [ENSMUST00000133809]
Predicted Effect probably benign
Transcript: ENSMUST00000028368
SMART Domains Protein: ENSMUSP00000028368
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Ubox 405 468 1.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102751
SMART Domains Protein: ENSMUSP00000099812
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Pfam:U-box 402 423 9.3e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133809
AA Change: L150H
SMART Domains Protein: ENSMUSP00000114814
Gene: ENSMUSG00000026988
AA Change: L150H

DomainStartEndE-ValueType
WD40 7 46 1.5e-3 SMART
WD40 48 96 2.48e-4 SMART
WD40 106 145 6e-3 SMART
low complexity region 163 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139689
SMART Domains Protein: ENSMUSP00000121438
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 32 4.28e0 SMART
WD40 34 82 2.48e-4 SMART
WD40 92 131 4.91e-8 SMART
WD40 134 173 7.05e-9 SMART
Pfam:SAM_2 193 241 5.3e-10 PFAM
Pfam:SAM_1 194 241 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144343
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,303,402 N868K probably benign Het
Cep112 T C 11: 108,855,870 S980P probably damaging Het
Dlk1 A G 12: 109,460,278 E95G probably damaging Het
Dnah6 A T 6: 73,035,280 probably null Het
Dppa2 A T 16: 48,314,160 H118L possibly damaging Het
Eif4enif1 T C 11: 3,242,463 S740P probably damaging Het
Eva1b T C 4: 126,149,472 S102P probably benign Het
Fndc3a G A 14: 72,559,248 R637* probably null Het
Fras1 A T 5: 96,758,094 D3119V possibly damaging Het
Hmgcr T C 13: 96,658,982 T360A probably benign Het
Kif21a A G 15: 90,966,407 V1017A probably damaging Het
Lats2 A G 14: 57,699,365 S556P probably damaging Het
Lrrc7 A G 3: 158,135,303 F1366S probably benign Het
Mtmr2 C A 9: 13,796,133 A327E probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr823 T C 10: 130,111,870 T307A probably benign Het
Ovch2 A T 7: 107,789,094 H426Q probably benign Het
Plxna1 A T 6: 89,324,400 V1506E probably damaging Het
Poldip3 A T 15: 83,133,200 S225T probably damaging Het
Polr3h A G 15: 81,918,304 L108P possibly damaging Het
Prss44 G A 9: 110,817,203 V333M probably damaging Het
Ptprk C T 10: 28,595,811 R1432C probably damaging Het
Rpl36al A G 12: 69,182,934 L68P probably damaging Het
Tagap T C 17: 7,927,074 S26P possibly damaging Het
Vapb A G 2: 173,771,569 K87R probably damaging Het
Vmn1r35 G A 6: 66,678,864 T274I possibly damaging Het
Xrcc5 C T 1: 72,383,362 S651L possibly damaging Het
Zfyve27 T A 19: 42,181,497 probably null Het
Other mutations in Wdsub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Wdsub1 APN 2 59858736 missense probably damaging 1.00
IGL02887:Wdsub1 APN 2 59852832 missense probably damaging 0.99
IGL02984:Wdsub1 UTSW 2 59876829 missense probably damaging 1.00
R0116:Wdsub1 UTSW 2 59876665 unclassified probably null
R0504:Wdsub1 UTSW 2 59878325 missense possibly damaging 0.93
R1437:Wdsub1 UTSW 2 59878133 missense probably damaging 0.98
R1452:Wdsub1 UTSW 2 59876800 missense probably null
R1566:Wdsub1 UTSW 2 59876715 missense probably damaging 1.00
R1767:Wdsub1 UTSW 2 59858714 missense probably damaging 1.00
R2938:Wdsub1 UTSW 2 59873286 missense possibly damaging 0.68
R4209:Wdsub1 UTSW 2 59876805 missense probably damaging 1.00
R4583:Wdsub1 UTSW 2 59878317 missense probably damaging 1.00
R4794:Wdsub1 UTSW 2 59862844 missense possibly damaging 0.78
R4803:Wdsub1 UTSW 2 59870399 intron probably benign
R4987:Wdsub1 UTSW 2 59870393 intron probably benign
R4989:Wdsub1 UTSW 2 59870414 intron probably benign
R5311:Wdsub1 UTSW 2 59878529 utr 5 prime probably benign
R5402:Wdsub1 UTSW 2 59870478 missense probably benign
R5408:Wdsub1 UTSW 2 59861543 unclassified probably benign
R5572:Wdsub1 UTSW 2 59862707 missense possibly damaging 0.95
R5681:Wdsub1 UTSW 2 59852895 missense probably damaging 1.00
R5864:Wdsub1 UTSW 2 59878475 missense probably damaging 1.00
R6582:Wdsub1 UTSW 2 59878308 missense probably damaging 1.00
R6678:Wdsub1 UTSW 2 59862631 missense probably benign 0.45
R6842:Wdsub1 UTSW 2 59878188 missense probably benign 0.09
R6907:Wdsub1 UTSW 2 59861684 missense possibly damaging 0.59
R7041:Wdsub1 UTSW 2 59852880 missense probably damaging 1.00
R7288:Wdsub1 UTSW 2 59878143 missense possibly damaging 0.50
R7769:Wdsub1 UTSW 2 59878419 missense probably damaging 1.00
X0023:Wdsub1 UTSW 2 59876754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTATGACCCTCCTGG -3'
(R):5'- CACTATGGCCAGAAAAGCTTTC -3'

Sequencing Primer
(F):5'- ATTTCTGAGTTCGAGGCCAGCC -3'
(R):5'- CTGAGAAAATTCATCCGTTTGCC -3'
Posted On2018-06-22