Incidental Mutation 'R6605:Gpr19'
List |< first << previous [record 15 of 40] next >> last >|
ID525582
Institutional Source Beutler Lab
Gene Symbol Gpr19
Ensembl Gene ENSMUSG00000032641
Gene NameG protein-coupled receptor 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location134869093-134898578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134870435 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 58 (N58S)
Ref Sequence ENSEMBL: ENSMUSP00000149995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046255] [ENSMUST00000066107] [ENSMUST00000111932] [ENSMUST00000116515] [ENSMUST00000165392] [ENSMUST00000203409] [ENSMUST00000203762] [ENSMUST00000204880] [ENSMUST00000215088]
Predicted Effect probably benign
Transcript: ENSMUST00000046255
AA Change: N9S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047630
Gene: ENSMUSG00000032641
AA Change: N9S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 76 345 1.7e-12 PFAM
Pfam:7tm_1 82 330 1.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066107
AA Change: N95S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000066287
Gene: ENSMUSG00000032641
AA Change: N95S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 76 345 1.7e-12 PFAM
Pfam:7tm_1 82 330 5.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111932
AA Change: N3S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107563
Gene: ENSMUSG00000032641
AA Change: N3S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116515
AA Change: N3S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112214
Gene: ENSMUSG00000032641
AA Change: N3S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165392
AA Change: N3S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127876
Gene: ENSMUSG00000032641
AA Change: N3S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203409
AA Change: N3S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000145128
Gene: ENSMUSG00000032641
AA Change: N3S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 132 9e-5 PFAM
Pfam:7tm_1 76 135 2.6e-16 PFAM
Predicted Effect silent
Transcript: ENSMUST00000203762
Predicted Effect probably benign
Transcript: ENSMUST00000204880
AA Change: N3S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144918
Gene: ENSMUSG00000032641
AA Change: N3S

DomainStartEndE-ValueType
transmembrane domain 59 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215088
AA Change: N58S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased anxiety-like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Gpr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gpr19 APN 6 134869742 missense probably damaging 0.99
IGL01373:Gpr19 APN 6 134870321 missense possibly damaging 0.81
IGL01988:Gpr19 APN 6 134869284 missense probably damaging 1.00
R1530:Gpr19 UTSW 6 134869998 missense probably damaging 0.97
R1548:Gpr19 UTSW 6 134870084 missense possibly damaging 0.92
R1699:Gpr19 UTSW 6 134870229 missense possibly damaging 0.93
R2131:Gpr19 UTSW 6 134870442 start codon destroyed probably null 0.99
R5016:Gpr19 UTSW 6 134869917 nonsense probably null
R7080:Gpr19 UTSW 6 134870456 missense probably damaging 0.99
R7746:Gpr19 UTSW 6 134869392 missense probably damaging 1.00
R8014:Gpr19 UTSW 6 134869473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGGAATTGCCAAAGATG -3'
(R):5'- ATACATAGTGCTGTGTGCCCG -3'

Sequencing Primer
(F):5'- CGCCAAAGAAGATGCTGGC -3'
(R):5'- CCGGTCTGTGCCATAGTG -3'
Posted On2018-06-22