Incidental Mutation 'R6638:Ovch2'
ID 525583
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Name ovochymase 2
Synonyms 9230106D23Rik
MMRRC Submission 044759-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6638 (G1)
Quality Score 208.009
Status Not validated
Chromosome 7
Chromosomal Location 107380751-107400386 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107388301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 426 (H426Q)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
AlphaFold Q7M761
Predicted Effect probably benign
Transcript: ENSMUST00000106755
AA Change: H426Q

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: H426Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208448
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,451,521 (GRCm39) N868K probably benign Het
Cep112 T C 11: 108,746,696 (GRCm39) S980P probably damaging Het
Dlk1 A G 12: 109,426,204 (GRCm39) E95G probably damaging Het
Dnah6 A T 6: 73,012,263 (GRCm39) probably null Het
Dppa2 A T 16: 48,134,523 (GRCm39) H118L possibly damaging Het
Eif4enif1 T C 11: 3,192,463 (GRCm39) S740P probably damaging Het
Eva1b T C 4: 126,043,265 (GRCm39) S102P probably benign Het
Fndc3a G A 14: 72,796,688 (GRCm39) R637* probably null Het
Fras1 A T 5: 96,905,953 (GRCm39) D3119V possibly damaging Het
Hmgcr T C 13: 96,795,490 (GRCm39) T360A probably benign Het
Kif21a A G 15: 90,850,610 (GRCm39) V1017A probably damaging Het
Lats2 A G 14: 57,936,822 (GRCm39) S556P probably damaging Het
Lrrc7 A G 3: 157,840,940 (GRCm39) F1366S probably benign Het
Mtmr2 C A 9: 13,707,429 (GRCm39) A327E probably damaging Het
Naip6 C A 13: 100,436,909 (GRCm39) S538I probably benign Het
Or9r3 T C 10: 129,947,739 (GRCm39) T307A probably benign Het
Plxna1 A T 6: 89,301,382 (GRCm39) V1506E probably damaging Het
Poldip3 A T 15: 83,017,401 (GRCm39) S225T probably damaging Het
Polr3h A G 15: 81,802,505 (GRCm39) L108P possibly damaging Het
Prss44 G A 9: 110,646,271 (GRCm39) V333M probably damaging Het
Ptprk C T 10: 28,471,807 (GRCm39) R1432C probably damaging Het
Rpl36al A G 12: 69,229,708 (GRCm39) L68P probably damaging Het
Tagap T C 17: 8,145,906 (GRCm39) S26P possibly damaging Het
Vapb A G 2: 173,613,362 (GRCm39) K87R probably damaging Het
Vmn1r35 G A 6: 66,655,848 (GRCm39) T274I possibly damaging Het
Wdsub1 A T 2: 59,700,785 (GRCm39) probably benign Het
Xrcc5 C T 1: 72,422,521 (GRCm39) S651L possibly damaging Het
Zfyve27 T A 19: 42,169,936 (GRCm39) probably null Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107,388,297 (GRCm39) missense probably null 1.00
IGL02198:Ovch2 APN 7 107,394,041 (GRCm39) missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107,394,030 (GRCm39) missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107,395,755 (GRCm39) missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107,389,405 (GRCm39) missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107,394,138 (GRCm39) missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107,400,343 (GRCm39) missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107,381,243 (GRCm39) missense probably benign
R0631:Ovch2 UTSW 7 107,381,228 (GRCm39) missense probably benign 0.01
R1028:Ovch2 UTSW 7 107,395,755 (GRCm39) missense probably benign 0.37
R1329:Ovch2 UTSW 7 107,384,653 (GRCm39) missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107,389,412 (GRCm39) critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107,389,402 (GRCm39) missense probably benign 0.02
R2265:Ovch2 UTSW 7 107,383,782 (GRCm39) missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107,394,122 (GRCm39) missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107,384,699 (GRCm39) missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107,395,775 (GRCm39) missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107,395,755 (GRCm39) missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107,391,341 (GRCm39) missense probably benign 0.26
R5353:Ovch2 UTSW 7 107,393,631 (GRCm39) missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107,393,201 (GRCm39) missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107,392,606 (GRCm39) missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107,381,185 (GRCm39) missense probably benign
R5979:Ovch2 UTSW 7 107,393,595 (GRCm39) missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107,395,779 (GRCm39) missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107,384,648 (GRCm39) missense probably damaging 1.00
R6877:Ovch2 UTSW 7 107,389,315 (GRCm39) missense probably benign 0.25
R7040:Ovch2 UTSW 7 107,395,772 (GRCm39) missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107,393,640 (GRCm39) missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107,393,577 (GRCm39) missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107,388,295 (GRCm39) critical splice donor site probably null
R7841:Ovch2 UTSW 7 107,393,298 (GRCm39) missense probably benign 0.01
R7908:Ovch2 UTSW 7 107,388,326 (GRCm39) missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107,393,207 (GRCm39) missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107,389,584 (GRCm39) missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107,393,251 (GRCm39) nonsense probably null
R8812:Ovch2 UTSW 7 107,392,462 (GRCm39) missense probably damaging 1.00
R9250:Ovch2 UTSW 7 107,392,542 (GRCm39) missense probably damaging 1.00
R9301:Ovch2 UTSW 7 107,395,815 (GRCm39) missense probably damaging 1.00
R9308:Ovch2 UTSW 7 107,389,560 (GRCm39) missense probably benign 0.03
R9703:Ovch2 UTSW 7 107,383,777 (GRCm39) missense probably damaging 1.00
R9717:Ovch2 UTSW 7 107,393,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGCCAGTGATCAGGAAC -3'
(R):5'- TCCCTAGGGCATGTGACTAG -3'

Sequencing Primer
(F):5'- GCCAGTGATCAGGAACTTTCAG -3'
(R):5'- ATGTGACTAGTGCCATTTTCCAGAC -3'
Posted On 2018-06-22