Incidental Mutation 'R6638:Ovch2'
ID525583
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Nameovochymase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6638 (G1)
Quality Score208.009
Status Not validated
Chromosome7
Chromosomal Location107781544-107801208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107789094 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 426 (H426Q)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
Predicted Effect probably benign
Transcript: ENSMUST00000106755
AA Change: H426Q

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: H426Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208448
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,303,402 N868K probably benign Het
Cep112 T C 11: 108,855,870 S980P probably damaging Het
Dlk1 A G 12: 109,460,278 E95G probably damaging Het
Dnah6 A T 6: 73,035,280 probably null Het
Dppa2 A T 16: 48,314,160 H118L possibly damaging Het
Eif4enif1 T C 11: 3,242,463 S740P probably damaging Het
Eva1b T C 4: 126,149,472 S102P probably benign Het
Fndc3a G A 14: 72,559,248 R637* probably null Het
Fras1 A T 5: 96,758,094 D3119V possibly damaging Het
Hmgcr T C 13: 96,658,982 T360A probably benign Het
Kif21a A G 15: 90,966,407 V1017A probably damaging Het
Lats2 A G 14: 57,699,365 S556P probably damaging Het
Lrrc7 A G 3: 158,135,303 F1366S probably benign Het
Mtmr2 C A 9: 13,796,133 A327E probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr823 T C 10: 130,111,870 T307A probably benign Het
Plxna1 A T 6: 89,324,400 V1506E probably damaging Het
Poldip3 A T 15: 83,133,200 S225T probably damaging Het
Polr3h A G 15: 81,918,304 L108P possibly damaging Het
Prss44 G A 9: 110,817,203 V333M probably damaging Het
Ptprk C T 10: 28,595,811 R1432C probably damaging Het
Rpl36al A G 12: 69,182,934 L68P probably damaging Het
Tagap T C 17: 7,927,074 S26P possibly damaging Het
Vapb A G 2: 173,771,569 K87R probably damaging Het
Vmn1r35 G A 6: 66,678,864 T274I possibly damaging Het
Wdsub1 A T 2: 59,870,441 probably benign Het
Xrcc5 C T 1: 72,383,362 S651L possibly damaging Het
Zfyve27 T A 19: 42,181,497 probably null Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107789090 missense probably null 1.00
IGL02198:Ovch2 APN 7 107794834 missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107794823 missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107796548 missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107790198 missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107794931 missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107801136 missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107782036 missense probably benign
R0631:Ovch2 UTSW 7 107782021 missense probably benign 0.01
R1028:Ovch2 UTSW 7 107796548 missense probably benign 0.37
R1329:Ovch2 UTSW 7 107785446 missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107790205 critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107790195 missense probably benign 0.02
R2265:Ovch2 UTSW 7 107784575 missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107794915 missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107785492 missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107796568 missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107796548 missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107792134 missense probably benign 0.26
R5353:Ovch2 UTSW 7 107794424 missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107793994 missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107793399 missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107781978 missense probably benign
R5979:Ovch2 UTSW 7 107794388 missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107796572 missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107785441 missense probably damaging 1.00
R6877:Ovch2 UTSW 7 107790108 missense probably benign 0.25
R7040:Ovch2 UTSW 7 107796565 missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107794433 missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107794370 missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107789088 critical splice donor site probably null
R7841:Ovch2 UTSW 7 107794091 missense probably benign 0.01
R7908:Ovch2 UTSW 7 107789119 missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107794000 missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107790377 missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107793255 missense probably damaging 1.00
R8812:Ovch2 UTSW 7 107794044 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGGCCAGTGATCAGGAAC -3'
(R):5'- TCCCTAGGGCATGTGACTAG -3'

Sequencing Primer
(F):5'- GCCAGTGATCAGGAACTTTCAG -3'
(R):5'- ATGTGACTAGTGCCATTTTCCAGAC -3'
Posted On2018-06-22