Incidental Mutation 'R6605:Zfp772'
List |< first << previous [record 39 of 40] next >> last >|
ID525584
Institutional Source Beutler Lab
Gene Symbol Zfp772
Ensembl Gene ENSMUSG00000066838
Gene Namezinc finger protein 772
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6605 (G1)
Quality Score146.011
Status Validated
Chromosome7
Chromosomal Location7202117-7209998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7205548 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 99 (E99G)
Ref Sequence ENSEMBL: ENSMUSP00000074055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074455
AA Change: E99G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074055
Gene: ENSMUSG00000066838
AA Change: E99G

DomainStartEndE-ValueType
KRAB 42 102 1.87e-14 SMART
ZnF_C2H2 193 215 1.36e-2 SMART
ZnF_C2H2 221 243 5.21e-4 SMART
ZnF_C2H2 249 271 1.38e-3 SMART
ZnF_C2H2 277 299 4.24e-4 SMART
ZnF_C2H2 305 327 5.21e-4 SMART
ZnF_C2H2 333 355 2.27e-4 SMART
ZnF_C2H2 361 383 1.18e-2 SMART
ZnF_C2H2 389 411 4.87e-4 SMART
Meta Mutation Damage Score 0.1163 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Zfp772
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Zfp772 APN 7 7204116 missense probably benign
IGL01589:Zfp772 APN 7 7205524 missense possibly damaging 0.53
PIT4449001:Zfp772 UTSW 7 7204351 missense probably benign 0.03
R1945:Zfp772 UTSW 7 7203630 missense probably benign 0.01
R3085:Zfp772 UTSW 7 7203700 missense possibly damaging 0.53
R5300:Zfp772 UTSW 7 7204158 missense probably benign
R5793:Zfp772 UTSW 7 7204284 missense probably benign 0.00
R6252:Zfp772 UTSW 7 7204019 missense possibly damaging 0.86
R6751:Zfp772 UTSW 7 7203717 missense possibly damaging 0.90
R6812:Zfp772 UTSW 7 7206308 missense possibly damaging 0.92
R8171:Zfp772 UTSW 7 7204097 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCACAATACAGGAACAGCTGTG -3'
(R):5'- TCGGAATGTAGCAGGAATTGTG -3'

Sequencing Primer
(F):5'- TACAGGAACAGCTGTGTATCAC -3'
(R):5'- AATTGTGGCACTGGTCAGC -3'
Posted On2018-06-22