Incidental Mutation 'R6605:Fosb'
ID525587
Institutional Source Beutler Lab
Gene Symbol Fosb
Ensembl Gene ENSMUSG00000003545
Gene NameFBJ osteosarcoma oncogene B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6605 (G1)
Quality Score219.009
Status Validated
Chromosome7
Chromosomal Location19302696-19310051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19309358 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 25 (Y25C)
Ref Sequence ENSEMBL: ENSMUSP00000146789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003640] [ENSMUST00000207334] [ENSMUST00000207716] [ENSMUST00000208326] [ENSMUST00000208446] [ENSMUST00000208505]
Predicted Effect probably damaging
Transcript: ENSMUST00000003640
AA Change: Y25C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003640
Gene: ENSMUSG00000003545
AA Change: Y25C

DomainStartEndE-ValueType
low complexity region 113 132 N/A INTRINSIC
BRLZ 153 217 5.58e-13 SMART
low complexity region 255 265 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207334
AA Change: Y25C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207716
AA Change: Y25C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208230
Predicted Effect probably damaging
Transcript: ENSMUST00000208326
AA Change: Y25C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208446
AA Change: Y25C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208505
AA Change: Y25C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1414 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show impaired nurturing behavior, altered behavioral tolerance to repeated motor seizures, reduced NMDA-mediated synaptic currents, and altered paradoxical sleep. Aging mice homozygous for another null allele may exhibit occasional tonic-clonic or generalized seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Fosb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fosb APN 7 19307114 splice site probably null
R0183:Fosb UTSW 7 19307385 missense probably damaging 0.99
R0374:Fosb UTSW 7 19307150 missense probably damaging 0.99
R0555:Fosb UTSW 7 19307213 missense possibly damaging 0.84
R2329:Fosb UTSW 7 19307185 missense probably benign
R3498:Fosb UTSW 7 19306632 missense probably damaging 1.00
R4064:Fosb UTSW 7 19305192 nonsense probably null
R4790:Fosb UTSW 7 19309388 missense probably damaging 1.00
R6327:Fosb UTSW 7 19307227 missense probably benign
R7282:Fosb UTSW 7 19305188 missense possibly damaging 0.62
R7444:Fosb UTSW 7 19307274 missense possibly damaging 0.86
R7764:Fosb UTSW 7 19305046 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AACTATTGCAATCCCAGATCCTG -3'
(R):5'- CGAACCGGAGACTAAGCTTC -3'

Sequencing Primer
(F):5'- CAGATCCTGGGTTTTGGCGC -3'
(R):5'- CGCACTTTGGAGACGTGTC -3'
Posted On2018-06-22