Incidental Mutation 'R6605:Pou2f2'
List |< first << previous [record 27 of 40] next >> last >|
ID525589
Institutional Source Beutler Lab
Gene Symbol Pou2f2
Ensembl Gene ENSMUSG00000008496
Gene NamePOU domain, class 2, transcription factor 2
SynonymsOct-2, Otf-2, Oct2a, Otf2, Oct2b
MMRRC Submission
Accession Numbers

Genbank: NM_001163554; MGI: 101897

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6605 (G1)
Quality Score138.008
Status Validated
Chromosome7
Chromosomal Location25087344-25179726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 25093581 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 441 (V441G)
Ref Sequence ENSEMBL: ENSMUSP00000096276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098679] [ENSMUST00000108413] [ENSMUST00000108415] [ENSMUST00000108416] [ENSMUST00000108417] [ENSMUST00000108418] [ENSMUST00000175774] [ENSMUST00000176408]
Predicted Effect probably damaging
Transcript: ENSMUST00000098679
AA Change: V441G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096276
Gene: ENSMUSG00000008496
AA Change: V441G

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108413
SMART Domains Protein: ENSMUSP00000104051
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 373 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108415
AA Change: V435G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104053
Gene: ENSMUSG00000008496
AA Change: V435G

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108416
AA Change: V380G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104054
Gene: ENSMUSG00000008496
AA Change: V380G

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
POU 140 214 7.65e-52 SMART
low complexity region 220 233 N/A INTRINSIC
HOX 242 304 3.8e-18 SMART
low complexity region 331 355 N/A INTRINSIC
low complexity region 361 371 N/A INTRINSIC
low complexity region 372 395 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108417
AA Change: V441G

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104055
Gene: ENSMUSG00000008496
AA Change: V441G

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108418
AA Change: V419G

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104056
Gene: ENSMUSG00000008496
AA Change: V419G

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
low complexity region 490 509 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175774
AA Change: V419G

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135075
Gene: ENSMUSG00000008496
AA Change: V419G

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176408
AA Change: V435G

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135326
Gene: ENSMUSG00000008496
AA Change: V435G

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184150
Meta Mutation Damage Score 0.1185 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this locus results in failed B cell maturation and death within hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Pou2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pou2f2 APN 7 25092700 nonsense probably null
IGL01420:Pou2f2 APN 7 25092952 missense possibly damaging 0.79
IGL02219:Pou2f2 APN 7 25097682 missense probably damaging 1.00
IGL03038:Pou2f2 APN 7 25097152 missense probably damaging 1.00
IGL03173:Pou2f2 APN 7 25099946 splice site probably benign
D3080:Pou2f2 UTSW 7 25097133 splice site probably benign
R0347:Pou2f2 UTSW 7 25097701 missense probably damaging 1.00
R0385:Pou2f2 UTSW 7 25116076 nonsense probably null
R0842:Pou2f2 UTSW 7 25096930 missense probably damaging 1.00
R1665:Pou2f2 UTSW 7 25092724 missense possibly damaging 0.66
R1914:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R1915:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R4076:Pou2f2 UTSW 7 25097288 missense probably damaging 0.98
R4811:Pou2f2 UTSW 7 25097686 nonsense probably null
R4863:Pou2f2 UTSW 7 25097108 intron probably benign
R5362:Pou2f2 UTSW 7 25092895 missense probably benign 0.02
R5995:Pou2f2 UTSW 7 25097444 missense probably damaging 1.00
R7541:Pou2f2 UTSW 7 25116128 missense probably benign 0.02
R7884:Pou2f2 UTSW 7 25116064 missense probably benign 0.39
R8123:Pou2f2 UTSW 7 25097008 missense possibly damaging 0.83
R8416:Pou2f2 UTSW 7 25116126 nonsense probably null
RF014:Pou2f2 UTSW 7 25115737 missense unknown
Z1177:Pou2f2 UTSW 7 25093176 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTCAACCCCACCATTGTG -3'
(R):5'- CTCTGAGTTTAGAGACTCTGGG -3'

Sequencing Primer
(F):5'- AACCCCACCATTGTGCTTCTG -3'
(R):5'- CTCTGGGTATACAATAGGGATCACC -3'
Posted On2018-06-22