Mutagenetix > Incidental Mutations

Incidental Mutation 'R6605:Abcc6'

525590

Institutional Source

Beutler Lab

Gene Symbol

Abcc6

Ensembl Gene

ENSMUSG00000030834

Gene Name

ATP-binding cassette, sub-family C (CFTR/MRP), member 6

Synonyms

Mrp6, DCC, Dyscalc1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.779) question?

Stock #

R6605 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45967555-46030302 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 45981057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1260 (I1260F)

Ref Sequence

ENSEMBL: ENSMUSP00000002850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002850]

AlphaFold

Q9R1S7

Predicted Effect

probably damaging
Transcript: ENSMUST00000002850
AA Change: I1260F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: I1260F

Domain	Start	End	E-Value	Type
transmembrane domain	44	61	N/A	INTRINSIC
transmembrane domain	81	100	N/A	INTRINSIC
transmembrane domain	110	129	N/A	INTRINSIC
transmembrane domain	142	161	N/A	INTRINSIC
transmembrane domain	171	193	N/A	INTRINSIC
Pfam:ABC_membrane	309	580	3.5e-29	PFAM
AAA	653	828	1.19e-9	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:ABC_membrane	942	1211	2.5e-32	PFAM
AAA	1286	1473	1.71e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209985

Predicted Effect

probably benign
Transcript: ENSMUST00000211220

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.8%

Validation Efficiency

92% (35/38)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	T	10: 82,296,037	S380T	probably benign	Het
Acat2	A	G	17: 12,943,887	V358A	probably benign	Het
Adgrv1	G	A	13: 81,487,962	A3476V	possibly damaging	Het
Akap13	A	G	7: 75,579,768	N150D	probably damaging	Het
Asb2	G	T	12: 103,345,684	Q60K	probably benign	Het
Asxl3	A	T	18: 22,517,077	R708*	probably null	Het
Cd79b	C	T	11: 106,312,713	G116D	probably damaging	Het
Copg2	A	G	6: 30,858,822	F218S	probably benign	Het
Defa5	A	C	8: 21,297,588	E50D	possibly damaging	Het
Eva1c	T	A	16: 90,866,348	V91D	probably damaging	Het
Fosb	T	C	7: 19,309,358	Y25C	probably damaging	Het
Gm11639	T	A	11: 104,999,281		probably null	Het
Gm5141	G	A	13: 62,774,387	H323Y	probably damaging	Het
Gpr19	T	C	6: 134,870,435	N58S	probably benign	Het
Gpr26	G	A	7: 131,984,164	A288T	possibly damaging	Het
Gucy2g	T	A	19: 55,241,028	Q70L	probably damaging	Het
Ifit2	C	T	19: 34,573,497	R146*	probably null	Het
Lgr5	A	C	10: 115,457,867	N408K	possibly damaging	Het
Lrp1	G	A	10: 127,560,136	H2422Y	probably damaging	Het
Mief1	T	A	15: 80,248,491	Y191*	probably null	Het
Npr3	C	G	15: 11,905,432	A70P	probably damaging	Het
Olfr10	A	T	11: 49,317,714	H56L	probably damaging	Het
Pcnt	A	G	10: 76,429,198		probably null	Het
Pnlip	A	T	19: 58,671,742	D29V	probably benign	Het
Pnpt1	T	A	11: 29,138,567	F277I	possibly damaging	Het
Pou2f2	A	C	7: 25,093,581	V441G	probably damaging	Het
Prdm4	A	G	10: 85,904,138	V459A	probably benign	Het
Ptprs	A	T	17: 56,422,195	V855E	probably damaging	Het
Rflna	A	G	5: 125,011,288	T100A	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Syn3	A	G	10: 86,057,564	S472P	unknown	Het
Taar8a	A	T	10: 24,076,776	I93F	possibly damaging	Het
Taok2	T	A	7: 126,878,758	D207V	probably damaging	Het
Tpst2	A	T	5: 112,276,734		probably benign	Homo
Trdv2-1	A	G	14: 53,946,542	N77S	possibly damaging	Het
Wdr17	A	C	8: 54,681,524	V18G	probably benign	Het
Zbtb17	T	C	4: 141,464,950	V402A	probably damaging	Het
Zfp772	T	C	7: 7,205,548	E99G	possibly damaging	Het
Zw10	A	G	9: 49,069,626	D442G	probably benign	Het

Other mutations in Abcc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01589:Abcc6	APN	7	46002672	splice site	probably benign
IGL01731:Abcc6	APN	7	46002610	missense	possibly damaging	0.71
IGL01743:Abcc6	APN	7	45996814	missense	probably benign	0.02
IGL01757:Abcc6	APN	7	45990281	splice site	probably benign
IGL01895:Abcc6	APN	7	46029058	missense	possibly damaging	0.88
IGL01942:Abcc6	APN	7	45986573	missense	possibly damaging	0.89
IGL02251:Abcc6	APN	7	45977416	missense	probably damaging	1.00
IGL02277:Abcc6	APN	7	46001061	missense	probably benign	0.00
IGL02548:Abcc6	APN	7	46005262	missense	probably damaging	0.98
IGL03063:Abcc6	APN	7	46016432	missense	probably benign
IGL03092:Abcc6	APN	7	45986470	missense	probably damaging	1.00
IGL03251:Abcc6	APN	7	45982237	unclassified	probably benign
R0057:Abcc6	UTSW	7	46020143	missense	probably benign	0.03
R0944:Abcc6	UTSW	7	46015505	missense	possibly damaging	0.81
R1019:Abcc6	UTSW	7	46014107	missense	possibly damaging	0.77
R1183:Abcc6	UTSW	7	45985253	missense	probably damaging	0.99
R1543:Abcc6	UTSW	7	46016504	missense	probably benign	0.01
R1550:Abcc6	UTSW	7	46005244	missense	probably benign	0.25
R1725:Abcc6	UTSW	7	45992357	missense	possibly damaging	0.76
R1907:Abcc6	UTSW	7	46014169	missense	probably benign	0.04
R1908:Abcc6	UTSW	7	46020134	splice site	probably null
R1909:Abcc6	UTSW	7	46020134	splice site	probably null
R2138:Abcc6	UTSW	7	45981051	missense	probably damaging	1.00
R2145:Abcc6	UTSW	7	45998741	missense	probably benign	0.01
R2402:Abcc6	UTSW	7	46015575	missense	probably benign	0.04
R3983:Abcc6	UTSW	7	45995289	missense	probably benign
R4013:Abcc6	UTSW	7	46018680	missense	probably benign	0.01
R4051:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4052:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4208:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4362:Abcc6	UTSW	7	45998832	splice site	probably benign
R4385:Abcc6	UTSW	7	45995328	missense	possibly damaging	0.93
R4399:Abcc6	UTSW	7	46002607	missense	probably benign
R4479:Abcc6	UTSW	7	46005239	missense	possibly damaging	0.60
R4480:Abcc6	UTSW	7	46005239	missense	possibly damaging	0.60
R4780:Abcc6	UTSW	7	45996691	missense	probably benign
R4791:Abcc6	UTSW	7	45982160	missense	probably benign	0.00
R4895:Abcc6	UTSW	7	45980990	missense	possibly damaging	0.95
R4898:Abcc6	UTSW	7	45989687	missense	probably damaging	0.96
R4905:Abcc6	UTSW	7	45995225	missense	probably benign
R4941:Abcc6	UTSW	7	46012523	missense	probably benign	0.00
R5040:Abcc6	UTSW	7	46020154	missense	probably benign	0.04
R5128:Abcc6	UTSW	7	45989646	missense	probably benign	0.00
R5284:Abcc6	UTSW	7	45981059	missense	probably benign	0.05
R5328:Abcc6	UTSW	7	45992311	missense	probably benign	0.01
R5459:Abcc6	UTSW	7	45982183	missense	probably benign	0.00
R5543:Abcc6	UTSW	7	45989536	critical splice donor site	probably null
R6178:Abcc6	UTSW	7	46029044	missense	probably benign
R6228:Abcc6	UTSW	7	46030256	missense	probably benign	0.02
R6532:Abcc6	UTSW	7	45977379	missense	probably damaging	1.00
R7000:Abcc6	UTSW	7	46005522	missense	possibly damaging	0.60
R7067:Abcc6	UTSW	7	46018690	missense	probably benign
R7553:Abcc6	UTSW	7	45999121	missense	probably damaging	1.00
R7597:Abcc6	UTSW	7	45995237	missense	probably damaging	1.00
R7718:Abcc6	UTSW	7	45977392	missense	possibly damaging	0.91
R7781:Abcc6	UTSW	7	46005606	missense	probably damaging	1.00
R7798:Abcc6	UTSW	7	45976853	nonsense	probably null
R7896:Abcc6	UTSW	7	45977379	missense	probably damaging	1.00
R8098:Abcc6	UTSW	7	45996665	missense	probably damaging	1.00
R8443:Abcc6	UTSW	7	45980025	missense	probably damaging	1.00
R8773:Abcc6	UTSW	7	45985145	missense	probably benign
R8784:Abcc6	UTSW	7	46002601	missense	probably benign
R8802:Abcc6	UTSW	7	46008859	missense	probably damaging	0.99
R8807:Abcc6	UTSW	7	45999007	missense	possibly damaging	0.67
R9006:Abcc6	UTSW	7	46016396	missense	probably benign	0.00
R9127:Abcc6	UTSW	7	45979760	missense	probably damaging	1.00
R9475:Abcc6	UTSW	7	46016468	missense	probably damaging	1.00
X0065:Abcc6	UTSW	7	46020197	missense	probably damaging	0.99
Z1176:Abcc6	UTSW	7	45979734	missense	probably damaging	1.00
Z1176:Abcc6	UTSW	7	45992306	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTCATACAGGGAGATCAAGGG -3'
(R):5'- ACCTGGAGTGGTTTCCAAATGG -3'

Sequencing Primer
(F):5'- ACCCCTAGAGGCAGATCAGG -3'
(R):5'- TCCAAATGGAAGGTGTATCAGG -3'

Posted On

2018-06-22