Incidental Mutation 'R6605:Abcc6'
ID 525590
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
MMRRC Submission 044728-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.841) question?
Stock # R6605 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45981057 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1260 (I1260F)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: I1260F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: I1260F

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209985
Predicted Effect probably benign
Transcript: ENSMUST00000211220
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 (GRCm38) S380T probably benign Het
Acat2 A G 17: 12,943,887 (GRCm38) V358A probably benign Het
Adgrv1 G A 13: 81,487,962 (GRCm38) A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 (GRCm38) N150D probably damaging Het
Asb2 G T 12: 103,345,684 (GRCm38) Q60K probably benign Het
Asxl3 A T 18: 22,517,077 (GRCm38) R708* probably null Het
Cd79b C T 11: 106,312,713 (GRCm38) G116D probably damaging Het
Copg2 A G 6: 30,858,822 (GRCm38) F218S probably benign Het
Defa5 A C 8: 21,297,588 (GRCm38) E50D possibly damaging Het
Eva1c T A 16: 90,866,348 (GRCm38) V91D probably damaging Het
Fosb T C 7: 19,309,358 (GRCm38) Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 (GRCm38) probably null Het
Gm5141 G A 13: 62,774,387 (GRCm38) H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 (GRCm38) N58S probably benign Het
Gpr26 G A 7: 131,984,164 (GRCm38) A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 (GRCm38) Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 (GRCm38) R146* probably null Het
Lgr5 A C 10: 115,457,867 (GRCm38) N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 (GRCm38) H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 (GRCm38) Y191* probably null Het
Npr3 C G 15: 11,905,432 (GRCm38) A70P probably damaging Het
Olfr10 A T 11: 49,317,714 (GRCm38) H56L probably damaging Het
Pcnt A G 10: 76,429,198 (GRCm38) probably null Het
Pnlip A T 19: 58,671,742 (GRCm38) D29V probably benign Het
Pnpt1 T A 11: 29,138,567 (GRCm38) F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 (GRCm38) V441G probably damaging Het
Prdm4 A G 10: 85,904,138 (GRCm38) V459A probably benign Het
Ptprs A T 17: 56,422,195 (GRCm38) V855E probably damaging Het
Rflna A G 5: 125,011,288 (GRCm38) T100A probably benign Het
Rnd2 C T 11: 101,468,999 (GRCm38) L57F probably damaging Het
Syn3 A G 10: 86,057,564 (GRCm38) S472P unknown Het
Taar8a A T 10: 24,076,776 (GRCm38) I93F possibly damaging Het
Taok2 T A 7: 126,878,758 (GRCm38) D207V probably damaging Het
Tpst2 A T 5: 112,276,734 (GRCm38) probably benign Homo
Trdv2-1 A G 14: 53,946,542 (GRCm38) N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 (GRCm38) V18G probably benign Het
Zbtb17 T C 4: 141,464,950 (GRCm38) V402A probably damaging Het
Zfp772 T C 7: 7,205,548 (GRCm38) E99G possibly damaging Het
Zw10 A G 9: 49,069,626 (GRCm38) D442G probably benign Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46,002,672 (GRCm38) splice site probably benign
IGL01731:Abcc6 APN 7 46,002,610 (GRCm38) missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45,996,814 (GRCm38) missense probably benign 0.02
IGL01757:Abcc6 APN 7 45,990,281 (GRCm38) splice site probably benign
IGL01895:Abcc6 APN 7 46,029,058 (GRCm38) missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45,986,573 (GRCm38) missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45,977,416 (GRCm38) missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46,001,061 (GRCm38) missense probably benign 0.00
IGL02548:Abcc6 APN 7 46,005,262 (GRCm38) missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46,016,432 (GRCm38) missense probably benign
IGL03092:Abcc6 APN 7 45,986,470 (GRCm38) missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45,982,237 (GRCm38) unclassified probably benign
R0057:Abcc6 UTSW 7 46,020,143 (GRCm38) missense probably benign 0.03
R0944:Abcc6 UTSW 7 46,015,505 (GRCm38) missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46,014,107 (GRCm38) missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45,985,253 (GRCm38) missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46,016,504 (GRCm38) missense probably benign 0.01
R1550:Abcc6 UTSW 7 46,005,244 (GRCm38) missense probably benign 0.25
R1725:Abcc6 UTSW 7 45,992,357 (GRCm38) missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46,014,169 (GRCm38) missense probably benign 0.04
R1908:Abcc6 UTSW 7 46,020,134 (GRCm38) splice site probably null
R1909:Abcc6 UTSW 7 46,020,134 (GRCm38) splice site probably null
R2138:Abcc6 UTSW 7 45,981,051 (GRCm38) missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45,998,741 (GRCm38) missense probably benign 0.01
R2402:Abcc6 UTSW 7 46,015,575 (GRCm38) missense probably benign 0.04
R3983:Abcc6 UTSW 7 45,995,289 (GRCm38) missense probably benign
R4013:Abcc6 UTSW 7 46,018,680 (GRCm38) missense probably benign 0.01
R4051:Abcc6 UTSW 7 45,986,563 (GRCm38) missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45,986,563 (GRCm38) missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45,986,563 (GRCm38) missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45,998,832 (GRCm38) splice site probably benign
R4385:Abcc6 UTSW 7 45,995,328 (GRCm38) missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46,002,607 (GRCm38) missense probably benign
R4479:Abcc6 UTSW 7 46,005,239 (GRCm38) missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46,005,239 (GRCm38) missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45,996,691 (GRCm38) missense probably benign
R4791:Abcc6 UTSW 7 45,982,160 (GRCm38) missense probably benign 0.00
R4895:Abcc6 UTSW 7 45,980,990 (GRCm38) missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45,989,687 (GRCm38) missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45,995,225 (GRCm38) missense probably benign
R4941:Abcc6 UTSW 7 46,012,523 (GRCm38) missense probably benign 0.00
R5040:Abcc6 UTSW 7 46,020,154 (GRCm38) missense probably benign 0.04
R5128:Abcc6 UTSW 7 45,989,646 (GRCm38) missense probably benign 0.00
R5284:Abcc6 UTSW 7 45,981,059 (GRCm38) missense probably benign 0.05
R5328:Abcc6 UTSW 7 45,992,311 (GRCm38) missense probably benign 0.01
R5459:Abcc6 UTSW 7 45,982,183 (GRCm38) missense probably benign 0.00
R5543:Abcc6 UTSW 7 45,989,536 (GRCm38) critical splice donor site probably null
R6178:Abcc6 UTSW 7 46,029,044 (GRCm38) missense probably benign
R6228:Abcc6 UTSW 7 46,030,256 (GRCm38) missense probably benign 0.02
R6532:Abcc6 UTSW 7 45,977,379 (GRCm38) missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46,005,522 (GRCm38) missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46,018,690 (GRCm38) missense probably benign
R7553:Abcc6 UTSW 7 45,999,121 (GRCm38) missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45,995,237 (GRCm38) missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45,977,392 (GRCm38) missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46,005,606 (GRCm38) missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45,976,853 (GRCm38) nonsense probably null
R7896:Abcc6 UTSW 7 45,977,379 (GRCm38) missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45,996,665 (GRCm38) missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45,980,025 (GRCm38) missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45,985,145 (GRCm38) missense probably benign
R8784:Abcc6 UTSW 7 46,002,601 (GRCm38) missense probably benign
R8802:Abcc6 UTSW 7 46,008,859 (GRCm38) missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45,999,007 (GRCm38) missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 46,016,396 (GRCm38) missense probably benign 0.00
R9127:Abcc6 UTSW 7 45,979,760 (GRCm38) missense probably damaging 1.00
R9475:Abcc6 UTSW 7 46,016,468 (GRCm38) missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45,979,773 (GRCm38) missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45,977,263 (GRCm38) missense probably damaging 1.00
R9642:Abcc6 UTSW 7 45,990,341 (GRCm38) missense probably benign 0.07
R9715:Abcc6 UTSW 7 45,979,935 (GRCm38) missense probably damaging 1.00
R9731:Abcc6 UTSW 7 46,020,236 (GRCm38) nonsense probably null
X0065:Abcc6 UTSW 7 46,020,197 (GRCm38) missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45,992,306 (GRCm38) critical splice donor site probably null
Z1176:Abcc6 UTSW 7 45,979,734 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCATACAGGGAGATCAAGGG -3'
(R):5'- ACCTGGAGTGGTTTCCAAATGG -3'

Sequencing Primer
(F):5'- ACCCCTAGAGGCAGATCAGG -3'
(R):5'- TCCAAATGGAAGGTGTATCAGG -3'
Posted On 2018-06-22