Incidental Mutation 'R6605:Abcc6'
List |< first << previous [record 2 of 40] next >> last >|
ID525590
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 6
SynonymsMrp6, DCC, Dyscalc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R6605 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45967555-46030302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45981057 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1260 (I1260F)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: I1260F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: I1260F

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209985
Predicted Effect probably benign
Transcript: ENSMUST00000211220
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTCATACAGGGAGATCAAGGG -3'
(R):5'- ACCTGGAGTGGTTTCCAAATGG -3'

Sequencing Primer
(F):5'- ACCCCTAGAGGCAGATCAGG -3'
(R):5'- TCCAAATGGAAGGTGTATCAGG -3'
Posted On2018-06-22