Incidental Mutation 'R6605:Taok2'
ID525594
Institutional Source Beutler Lab
Gene Symbol Taok2
Ensembl Gene ENSMUSG00000059981
Gene NameTAO kinase 2
SynonymsMAP3K17, TAO2, 1110033K02Rik, PSK1, TAO1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126865678-126884703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126878758 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 207 (D207V)
Ref Sequence ENSEMBL: ENSMUSP00000112963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071268] [ENSMUST00000117394]
Predicted Effect probably damaging
Transcript: ENSMUST00000071268
AA Change: D207V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071246
Gene: ENSMUSG00000059981
AA Change: D207V

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
coiled coil region 821 859 N/A INTRINSIC
low complexity region 863 892 N/A INTRINSIC
low complexity region 931 954 N/A INTRINSIC
low complexity region 963 972 N/A INTRINSIC
low complexity region 977 992 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117394
AA Change: D207V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112963
Gene: ENSMUSG00000059981
AA Change: D207V

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
transmembrane domain 962 984 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1017 1039 N/A INTRINSIC
transmembrane domain 1052 1074 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1197 1215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156273
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that is involved in many different processes, including, cell signaling, microtubule organization and stability, and apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. Mice homozygous for a targeted allele exhibit resistance to the ataxic effect of alcohol, reduced blood ethanol content, increased alcohol consumption, impaired CPP for alcohol, and impaired habituation in an open field. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Taok2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Taok2 APN 7 126872411 missense probably damaging 0.98
IGL01153:Taok2 APN 7 126871032 missense probably damaging 0.99
IGL02689:Taok2 APN 7 126876098 missense probably damaging 0.99
R0049:Taok2 UTSW 7 126866411 missense possibly damaging 0.92
R0601:Taok2 UTSW 7 126879433 missense probably damaging 1.00
R0976:Taok2 UTSW 7 126875151 missense possibly damaging 0.77
R1456:Taok2 UTSW 7 126880141 missense probably benign 0.09
R1643:Taok2 UTSW 7 126875938 unclassified probably benign
R2084:Taok2 UTSW 7 126870191 missense probably benign 0.04
R2212:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R2471:Taok2 UTSW 7 126875100 missense probably damaging 0.98
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3412:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R4085:Taok2 UTSW 7 126874725 missense possibly damaging 0.90
R4440:Taok2 UTSW 7 126866521 missense possibly damaging 0.85
R4775:Taok2 UTSW 7 126870768 missense probably damaging 0.99
R4787:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4788:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4791:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4927:Taok2 UTSW 7 126876041 missense probably damaging 1.00
R5651:Taok2 UTSW 7 126880283 missense probably damaging 1.00
R6371:Taok2 UTSW 7 126870147 missense probably damaging 1.00
R6408:Taok2 UTSW 7 126870992 missense probably benign
R6828:Taok2 UTSW 7 126871875 splice site probably null
R6863:Taok2 UTSW 7 126871937 missense probably damaging 0.99
R6962:Taok2 UTSW 7 126866916 critical splice acceptor site probably null
R6967:Taok2 UTSW 7 126870392 missense probably damaging 0.98
R7127:Taok2 UTSW 7 126867154 missense possibly damaging 0.82
R7187:Taok2 UTSW 7 126872380 missense probably damaging 0.99
R7307:Taok2 UTSW 7 126866818 missense probably damaging 1.00
R7325:Taok2 UTSW 7 126871088 missense probably benign
R7429:Taok2 UTSW 7 126870677 missense possibly damaging 0.95
R7497:Taok2 UTSW 7 126874878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCTAGCACACTGGGCAG -3'
(R):5'- CTGCCAACTCTTTTGTGGGTAC -3'

Sequencing Primer
(F):5'- CTCTGAGTTCAAGGCCAGTCTG -3'
(R):5'- TACTCCATACTGGTGAGTAAAAGAG -3'
Posted On2018-06-22