Incidental Mutation 'R6605:Gpr26'
List |< first << previous [record 16 of 40] next >> last >|
ID525596
Institutional Source Beutler Lab
Gene Symbol Gpr26
Ensembl Gene ENSMUSG00000040125
Gene NameG protein-coupled receptor 26
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6605 (G1)
Quality Score196.009
Status Validated
Chromosome7
Chromosomal Location131966460-131994405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131984164 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 288 (A288T)
Ref Sequence ENSEMBL: ENSMUSP00000041664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045840] [ENSMUST00000124096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045840
AA Change: A288T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041664
Gene: ENSMUSG00000040125
AA Change: A288T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 15 309 1.9e-7 PFAM
Pfam:7tm_1 22 294 1.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Meta Mutation Damage Score 0.1678 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-couple receptor protein. G-protein-coupled receptors are a large family of membrane proteins that are involved in cellular responses to environmental stimuli, neurotransmitters, and hormones. The encoded protein may play a role in neurodegenerative diseases. Epigenetic silencing of this gene has been observed in gliomas. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit increased anxiety- and depression-related behaviors and alcohol preference. Female mice homozygous for another allele display increased susceptibility to diet-induced obesity with increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Gpr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Gpr26 APN 7 131967501 missense probably damaging 1.00
IGL01345:Gpr26 APN 7 131967432 missense possibly damaging 0.90
IGL01658:Gpr26 APN 7 131984105 missense probably benign
IGL02724:Gpr26 APN 7 131974392 critical splice donor site probably null
R0408:Gpr26 UTSW 7 131967520 missense possibly damaging 0.81
R0408:Gpr26 UTSW 7 131974272 splice site probably null
R0547:Gpr26 UTSW 7 131984297 missense probably benign 0.01
R2508:Gpr26 UTSW 7 131967094 missense probably damaging 0.98
R4088:Gpr26 UTSW 7 131967076 missense probably benign 0.00
R4630:Gpr26 UTSW 7 131966980 missense probably damaging 1.00
R4680:Gpr26 UTSW 7 131974353 missense probably benign 0.34
R4756:Gpr26 UTSW 7 131967501 missense probably damaging 1.00
R5229:Gpr26 UTSW 7 131984247 missense probably damaging 1.00
R5610:Gpr26 UTSW 7 131966965 missense possibly damaging 0.94
R6653:Gpr26 UTSW 7 131984101 missense probably benign 0.00
R7213:Gpr26 UTSW 7 131967490 missense probably damaging 1.00
R7351:Gpr26 UTSW 7 131974365 missense probably damaging 1.00
R7768:Gpr26 UTSW 7 131974348 missense probably damaging 0.99
R7887:Gpr26 UTSW 7 131966973 missense probably benign
Z1088:Gpr26 UTSW 7 131984094 frame shift probably null
Z1176:Gpr26 UTSW 7 131967048 missense probably damaging 1.00
Z1176:Gpr26 UTSW 7 131967225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCTAATCAATGCTCATTGC -3'
(R):5'- CGTTCTGAACTCCCCATCAG -3'

Sequencing Primer
(F):5'- AATGCTCATTGCCACCATTTTTG -3'
(R):5'- CATCAGGAGAGTGGTCCTTCATTC -3'
Posted On2018-06-22