Incidental Mutation 'R6638:2210408I21Rik'
ID525601
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6638 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77303402 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 868 (N868K)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
Predicted Effect probably benign
Transcript: ENSMUST00000168779
AA Change: N868K

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: N868K

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cep112 T C 11: 108,855,870 S980P probably damaging Het
Dlk1 A G 12: 109,460,278 E95G probably damaging Het
Dnah6 A T 6: 73,035,280 probably null Het
Dppa2 A T 16: 48,314,160 H118L possibly damaging Het
Eif4enif1 T C 11: 3,242,463 S740P probably damaging Het
Eva1b T C 4: 126,149,472 S102P probably benign Het
Fndc3a G A 14: 72,559,248 R637* probably null Het
Fras1 A T 5: 96,758,094 D3119V possibly damaging Het
Hmgcr T C 13: 96,658,982 T360A probably benign Het
Kif21a A G 15: 90,966,407 V1017A probably damaging Het
Lats2 A G 14: 57,699,365 S556P probably damaging Het
Lrrc7 A G 3: 158,135,303 F1366S probably benign Het
Mtmr2 C A 9: 13,796,133 A327E probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr823 T C 10: 130,111,870 T307A probably benign Het
Ovch2 A T 7: 107,789,094 H426Q probably benign Het
Plxna1 A T 6: 89,324,400 V1506E probably damaging Het
Poldip3 A T 15: 83,133,200 S225T probably damaging Het
Polr3h A G 15: 81,918,304 L108P possibly damaging Het
Prss44 G A 9: 110,817,203 V333M probably damaging Het
Ptprk C T 10: 28,595,811 R1432C probably damaging Het
Rpl36al A G 12: 69,182,934 L68P probably damaging Het
Tagap T C 17: 7,927,074 S26P possibly damaging Het
Vapb A G 2: 173,771,569 K87R probably damaging Het
Vmn1r35 G A 6: 66,678,864 T274I possibly damaging Het
Wdsub1 A T 2: 59,870,441 probably benign Het
Xrcc5 C T 1: 72,383,362 S651L possibly damaging Het
Zfyve27 T A 19: 42,181,497 probably null Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77259895 missense probably benign
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 intron probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 synonymous probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77254204 missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77269902 missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77323571 missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77323536 missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77183609 missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77193195 missense probably benign
R7684:2210408I21Rik UTSW 13 77612540 nonsense probably null
R7728:2210408I21Rik UTSW 13 77316477 missense possibly damaging 0.96
R7881:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R7964:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R8008:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77612594 missense probably benign
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAACTGCACTAAGAAGCAAG -3'
(R):5'- TCCAAACAGAAGCTCTATAAGATGC -3'

Sequencing Primer
(F):5'- CTGCACTAAGAAGCAAGTGTATGTC -3'
(R):5'- GCATCAACCTTTGAAAGCA -3'
Posted On2018-06-22