Incidental Mutation 'R6605:Taar8a'
ID525604
Institutional Source Beutler Lab
Gene Symbol Taar8a
Ensembl Gene ENSMUSG00000096442
Gene Nametrace amine-associated receptor 8A
SynonymsLOC215859
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6605 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24076500-24077534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24076776 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 93 (I93F)
Ref Sequence ENSEMBL: ENSMUSP00000062719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051133]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051133
AA Change: I93F

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062719
Gene: ENSMUSG00000096442
AA Change: I93F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 40 244 3.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 42 327 7.1e-15 PFAM
Pfam:7tm_1 48 312 9.1e-58 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Taar8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Taar8a APN 10 24076861 missense probably damaging 1.00
IGL01546:Taar8a APN 10 24076915 missense possibly damaging 0.95
IGL01597:Taar8a APN 10 24076858 missense possibly damaging 0.96
IGL02387:Taar8a APN 10 24077362 missense possibly damaging 0.93
IGL02815:Taar8a APN 10 24077380 missense probably benign 0.02
R0762:Taar8a UTSW 10 24077077 missense probably benign 0.34
R1690:Taar8a UTSW 10 24076915 missense probably damaging 1.00
R2891:Taar8a UTSW 10 24077130 missense probably benign 0.02
R3889:Taar8a UTSW 10 24077025 missense probably benign 0.00
R3962:Taar8a UTSW 10 24077156 missense probably damaging 0.99
R4090:Taar8a UTSW 10 24077164 missense probably damaging 0.96
R6580:Taar8a UTSW 10 24076893 missense probably damaging 0.99
R7422:Taar8a UTSW 10 24076864 missense probably damaging 1.00
R7571:Taar8a UTSW 10 24077408 nonsense probably null
R8265:Taar8a UTSW 10 24076941 missense probably damaging 1.00
X0022:Taar8a UTSW 10 24077508 missense possibly damaging 0.93
X0062:Taar8a UTSW 10 24077381 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCTGTACATGGTCTATGGCTTTG -3'
(R):5'- AACACTGCACTGCTGTACAC -3'

Sequencing Primer
(F):5'- CTATGGCTTTGGGGCTGTGC -3'
(R):5'- CTGTACACCAGGGGCAGAATC -3'
Posted On2018-06-22