Incidental Mutation 'R6638:Poldip3'
ID525613
Institutional Source Beutler Lab
Gene Symbol Poldip3
Ensembl Gene ENSMUSG00000041815
Gene Namepolymerase (DNA-directed), delta interacting protein 3
Synonyms1110008P04Rik, PDIP46
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6638 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location83125976-83149384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83133200 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 225 (S225T)
Ref Sequence ENSEMBL: ENSMUSP00000097944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058793] [ENSMUST00000100375] [ENSMUST00000129372]
Predicted Effect probably damaging
Transcript: ENSMUST00000058793
AA Change: S254T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054548
Gene: ENSMUSG00000041815
AA Change: S254T

DomainStartEndE-ValueType
low complexity region 183 196 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
RRM 281 347 5.05e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100375
AA Change: S225T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097944
Gene: ENSMUSG00000041815
AA Change: S225T

DomainStartEndE-ValueType
low complexity region 154 167 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
RRM 252 318 5.05e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129372
AA Change: S193T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120859
Gene: ENSMUSG00000041815
AA Change: S193T

DomainStartEndE-ValueType
low complexity region 153 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150926
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RRM (RNA recognition motif)-containing protein that participates in the regulation of translation by recruiting ribosomal protein S6 kinase beta-1 to mRNAs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,303,402 N868K probably benign Het
Cep112 T C 11: 108,855,870 S980P probably damaging Het
Dlk1 A G 12: 109,460,278 E95G probably damaging Het
Dnah6 A T 6: 73,035,280 probably null Het
Dppa2 A T 16: 48,314,160 H118L possibly damaging Het
Eif4enif1 T C 11: 3,242,463 S740P probably damaging Het
Eva1b T C 4: 126,149,472 S102P probably benign Het
Fndc3a G A 14: 72,559,248 R637* probably null Het
Fras1 A T 5: 96,758,094 D3119V possibly damaging Het
Hmgcr T C 13: 96,658,982 T360A probably benign Het
Kif21a A G 15: 90,966,407 V1017A probably damaging Het
Lats2 A G 14: 57,699,365 S556P probably damaging Het
Lrrc7 A G 3: 158,135,303 F1366S probably benign Het
Mtmr2 C A 9: 13,796,133 A327E probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr823 T C 10: 130,111,870 T307A probably benign Het
Ovch2 A T 7: 107,789,094 H426Q probably benign Het
Plxna1 A T 6: 89,324,400 V1506E probably damaging Het
Polr3h A G 15: 81,918,304 L108P possibly damaging Het
Prss44 G A 9: 110,817,203 V333M probably damaging Het
Ptprk C T 10: 28,595,811 R1432C probably damaging Het
Rpl36al A G 12: 69,182,934 L68P probably damaging Het
Tagap T C 17: 7,927,074 S26P possibly damaging Het
Vapb A G 2: 173,771,569 K87R probably damaging Het
Vmn1r35 G A 6: 66,678,864 T274I possibly damaging Het
Wdsub1 A T 2: 59,870,441 probably benign Het
Xrcc5 C T 1: 72,383,362 S651L possibly damaging Het
Zfyve27 T A 19: 42,181,497 probably null Het
Other mutations in Poldip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Poldip3 APN 15 83138479 missense probably damaging 1.00
IGL02887:Poldip3 APN 15 83129268 unclassified probably benign
R0143:Poldip3 UTSW 15 83127943 missense probably damaging 1.00
R0201:Poldip3 UTSW 15 83135296 missense probably benign 0.00
R0511:Poldip3 UTSW 15 83138235 missense probably damaging 1.00
R1560:Poldip3 UTSW 15 83138326 missense probably damaging 1.00
R2302:Poldip3 UTSW 15 83129268 unclassified probably benign
R3755:Poldip3 UTSW 15 83131475 unclassified probably benign
R3756:Poldip3 UTSW 15 83131475 unclassified probably benign
R4785:Poldip3 UTSW 15 83131501 missense probably damaging 1.00
R4917:Poldip3 UTSW 15 83132575 critical splice donor site probably null
R4965:Poldip3 UTSW 15 83137505 missense possibly damaging 0.80
R5009:Poldip3 UTSW 15 83133194 missense probably damaging 1.00
R5030:Poldip3 UTSW 15 83138191 missense possibly damaging 0.67
R5992:Poldip3 UTSW 15 83129229 missense probably damaging 0.96
R7028:Poldip3 UTSW 15 83131497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATGTAGTGTGCTCTC -3'
(R):5'- TGGCCTGTATCACTGGTCTC -3'

Sequencing Primer
(F):5'- AGTGTGCTCTCTCTACCAGGG -3'
(R):5'- GCCTGTATCACTGGTCTCTCAGAC -3'
Posted On2018-06-22