Incidental Mutation 'R6605:Lgr5'
ID525614
Institutional Source Beutler Lab
Gene Symbol Lgr5
Ensembl Gene ENSMUSG00000020140
Gene Nameleucine rich repeat containing G protein coupled receptor 5
SynonymsGpr49
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010195.2; MGI: 1341817

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location115450311-115587780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115457867 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 408 (N408K)
Ref Sequence ENSEMBL: ENSMUSP00000133860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020350] [ENSMUST00000172806] [ENSMUST00000173740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020350
AA Change: N432K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020350
Gene: ENSMUSG00000020140
AA Change: N432K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR_TYP 256 279 1.38e-3 SMART
Blast:LRR 281 303 2e-6 BLAST
Blast:LRR 304 328 1e-5 BLAST
LRR_TYP 351 374 1.56e-2 SMART
LRR 375 396 1.09e2 SMART
LRR_TYP 397 420 7.26e-3 SMART
LRR 421 444 2.86e-1 SMART
low complexity region 518 533 N/A INTRINSIC
Pfam:7tm_1 574 820 9.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144732
Predicted Effect possibly damaging
Transcript: ENSMUST00000172806
AA Change: N408K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133860
Gene: ENSMUSG00000020140
AA Change: N408K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR 256 279 6.57e-1 SMART
Blast:LRR 280 304 1e-5 BLAST
LRR_TYP 327 350 1.56e-2 SMART
LRR 351 372 1.09e2 SMART
LRR_TYP 373 396 7.26e-3 SMART
LRR 397 420 2.86e-1 SMART
low complexity region 494 509 N/A INTRINSIC
Pfam:7tm_1 550 796 8.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173619
Predicted Effect probably benign
Transcript: ENSMUST00000173740
AA Change: N360K

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133707
Gene: ENSMUSG00000020140
AA Change: N360K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.08e-4 SMART
LRR 161 183 9.75e0 SMART
LRR_TYP 184 207 1.38e-3 SMART
Blast:LRR 209 231 1e-6 BLAST
Blast:LRR 232 256 1e-5 BLAST
LRR_TYP 279 302 1.56e-2 SMART
LRR 303 324 1.09e2 SMART
LRR_TYP 325 348 7.26e-3 SMART
LRR 349 372 2.86e-1 SMART
low complexity region 446 461 N/A INTRINSIC
Pfam:7tm_1 502 748 7.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype Strain: 3512420
Lethality: D1-D2
FUNCTION: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display 100% neonatal lethality associated with ankyloglossia, gastrointestinal distension, cyanosis and respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Lgr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lgr5 APN 10 115454464 missense possibly damaging 0.69
IGL01291:Lgr5 APN 10 115478534 missense probably damaging 1.00
IGL01432:Lgr5 APN 10 115453092 missense probably damaging 1.00
IGL01778:Lgr5 APN 10 115462702 missense probably damaging 0.97
IGL01936:Lgr5 APN 10 115452414 missense probably damaging 1.00
IGL02079:Lgr5 APN 10 115452194 missense probably damaging 1.00
IGL02134:Lgr5 APN 10 115452858 missense possibly damaging 0.89
IGL03083:Lgr5 APN 10 115453032 missense probably benign 0.26
IGL03350:Lgr5 APN 10 115471988 missense probably damaging 0.99
anger UTSW 10 115466346 missense probably benign 0.03
ANU05:Lgr5 UTSW 10 115478534 missense probably damaging 1.00
R0378:Lgr5 UTSW 10 115454499 missense probably damaging 1.00
R0788:Lgr5 UTSW 10 115452997 missense probably damaging 0.99
R1119:Lgr5 UTSW 10 115460811 critical splice donor site probably null
R1321:Lgr5 UTSW 10 115478457 missense probably damaging 1.00
R1880:Lgr5 UTSW 10 115452279 missense probably damaging 1.00
R1985:Lgr5 UTSW 10 115495245 splice site probably benign
R2434:Lgr5 UTSW 10 115587406 missense probably benign
R3055:Lgr5 UTSW 10 115466123 splice site probably benign
R3910:Lgr5 UTSW 10 115587463 missense possibly damaging 0.93
R4686:Lgr5 UTSW 10 115458743 intron probably benign
R4862:Lgr5 UTSW 10 115462764 missense probably damaging 1.00
R4866:Lgr5 UTSW 10 115452685 missense probably benign 0.00
R5089:Lgr5 UTSW 10 115478423 missense probably damaging 1.00
R5118:Lgr5 UTSW 10 115452339 missense possibly damaging 0.88
R5375:Lgr5 UTSW 10 115478564 missense probably benign 0.00
R5537:Lgr5 UTSW 10 115456689 missense probably benign 0.00
R5583:Lgr5 UTSW 10 115478504 missense probably benign 0.32
R6312:Lgr5 UTSW 10 115452924 missense probably damaging 1.00
R6362:Lgr5 UTSW 10 115478525 missense probably damaging 1.00
R6689:Lgr5 UTSW 10 115466608 missense probably damaging 0.99
R6705:Lgr5 UTSW 10 115587288 missense probably damaging 0.96
R6925:Lgr5 UTSW 10 115466346 missense probably benign 0.03
R7063:Lgr5 UTSW 10 115456734 missense probably damaging 1.00
R7261:Lgr5 UTSW 10 115587465 missense possibly damaging 0.96
R7274:Lgr5 UTSW 10 115452505 missense probably damaging 0.99
R7458:Lgr5 UTSW 10 115457755 critical splice donor site probably null
R7569:Lgr5 UTSW 10 115462756 missense probably damaging 1.00
R7770:Lgr5 UTSW 10 115471994 missense probably damaging 0.98
Z1176:Lgr5 UTSW 10 115460876 missense probably damaging 0.98
Z1177:Lgr5 UTSW 10 115456669 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACGACAACTGTTCTTTCACATG -3'
(R):5'- TGCATTTCAAGTGTGTCCCC -3'

Sequencing Primer
(F):5'- GACAACTGTTCTTTCACATGATCAC -3'
(R):5'- CAAGTGTGTCCCCCTAGTGTG -3'
Posted On2018-06-22