Incidental Mutation 'R6605:Cd79b'
ID525623
Institutional Source Beutler Lab
Gene Symbol Cd79b
Ensembl Gene ENSMUSG00000040592
Gene NameCD79B antigen
SynonymsIgbeta, Ig-beta, Igb, B29
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106311341-106314762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106312713 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 116 (G116D)
Ref Sequence ENSEMBL: ENSMUSP00000129029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044228] [ENSMUST00000167143]
PDB Structure
Crystal structure of murine Ig-beta (CD79b) homodimer [X-RAY DIFFRACTION]
Crystal structure of murine Ig-beta (CD79b) in the monomeric form [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000044228
AA Change: G176D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048239
Gene: ENSMUSG00000040592
AA Change: G176D

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
IG 110 202 3.56e-9 SMART
transmembrane domain 220 239 N/A INTRINSIC
ITAM 252 272 2.41e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167143
AA Change: G116D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129029
Gene: ENSMUSG00000040592
AA Change: G116D

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
IG 50 142 3.56e-9 SMART
transmembrane domain 160 179 N/A INTRINSIC
ITAM 192 212 2.41e-4 SMART
Meta Mutation Damage Score 0.9440 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Cd79b
AlleleSourceChrCoordTypePredicted EffectPPH Score
hallasan UTSW 11 106312441 critical splice acceptor site probably null
Jeju UTSW 11 106312713 missense probably damaging 1.00
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0731:Cd79b UTSW 11 106312433 missense probably damaging 1.00
R4400:Cd79b UTSW 11 106312010 nonsense probably null
R4591:Cd79b UTSW 11 106312046 missense probably damaging 1.00
R4948:Cd79b UTSW 11 106312861 missense probably benign 0.01
R6214:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R6215:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R7111:Cd79b UTSW 11 106314539 missense possibly damaging 0.73
R7114:Cd79b UTSW 11 106311887 missense probably damaging 1.00
R7401:Cd79b UTSW 11 106312852 missense probably benign 0.02
R8052:Cd79b UTSW 11 106313700 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGGACTCTAGAATCATAGCC -3'
(R):5'- GAAGCCCTTGTTCCCAGATC -3'

Sequencing Primer
(F):5'- GGGGACTCTAGAATCATAGCCACTTC -3'
(R):5'- AGCACCCGAGGTTTGCAG -3'
Posted On2018-06-22