Incidental Mutation 'R6605:Asb2'
List |< first << previous [record 6 of 40] next >> last >|
ID525625
Institutional Source Beutler Lab
Gene Symbol Asb2
Ensembl Gene ENSMUSG00000021200
Gene Nameankyrin repeat and SOCS box-containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6605 (G1)
Quality Score144.008
Status Validated
Chromosome12
Chromosomal Location103321142-103356001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103345684 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 60 (Q60K)
Ref Sequence ENSEMBL: ENSMUSP00000021617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021617]
Predicted Effect probably benign
Transcript: ENSMUST00000021617
AA Change: Q60K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000021617
Gene: ENSMUSG00000021200
AA Change: Q60K

DomainStartEndE-ValueType
UIM 26 45 1.02e0 SMART
ANK 104 133 1.81e2 SMART
ANK 137 167 5.45e-2 SMART
ANK 171 200 5.45e-2 SMART
ANK 204 233 2.21e-2 SMART
ANK 237 266 9.13e-4 SMART
ANK 270 299 7.42e-4 SMART
ANK 303 332 1.19e-2 SMART
ANK 336 365 5.67e0 SMART
ANK 368 397 6.02e-4 SMART
ANK 410 439 3.54e-1 SMART
ANK 440 469 6.81e-3 SMART
SOCS_box 592 631 2.51e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160463
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ankyrin repeat and SOCS box-containing (ASB) protein family. These proteins play a role in protein degradation by coupling suppressor of cytokine signalling (SOCS) proteins with the elongin BC complex. The encoded protein is a subunit of a multimeric E3 ubiquitin ligase complex that mediates the degradation of actin-binding proteins. This gene plays a role in retinoic acid-induced growth inhibition and differentiation of myeloid leukemia cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a conditional cells activated in the immune system exhibit impaired immature dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Asb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Asb2 APN 12 103335905 missense possibly damaging 0.93
IGL01878:Asb2 APN 12 103321663 missense possibly damaging 0.89
IGL02103:Asb2 APN 12 103333496 nonsense probably null
IGL02936:Asb2 APN 12 103335914 missense probably benign 0.04
R0178:Asb2 UTSW 12 103325552 missense probably damaging 1.00
R0208:Asb2 UTSW 12 103325271 missense possibly damaging 0.77
R0844:Asb2 UTSW 12 103325546 missense probably damaging 1.00
R1309:Asb2 UTSW 12 103325408 missense probably benign
R2931:Asb2 UTSW 12 103334887 missense probably damaging 1.00
R4057:Asb2 UTSW 12 103325394 missense probably benign
R4735:Asb2 UTSW 12 103325058 missense probably benign 0.43
R4754:Asb2 UTSW 12 103323837 missense possibly damaging 0.95
R5916:Asb2 UTSW 12 103323876 missense probably damaging 1.00
R5946:Asb2 UTSW 12 103321555 missense probably benign 0.00
R6349:Asb2 UTSW 12 103345859 start codon destroyed probably null 0.07
R7317:Asb2 UTSW 12 103333357 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATGTGAAAGACTTGGGCCACAG -3'
(R):5'- ATGGCGACTGAGATCTCCAC -3'

Sequencing Primer
(F):5'- GGATCCCATCCCACTGTGAC -3'
(R):5'- ACTGAGATCTCCACTCGGG -3'
Posted On2018-06-22