Incidental Mutation 'R6605:Gm5141'
List |< first << previous [record 14 of 40] next >> last >|
ID525627
Institutional Source Beutler Lab
Gene Symbol Gm5141
Ensembl Gene ENSMUSG00000091183
Gene Namepredicted gene 5141
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location62772200-62785808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62774387 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 323 (H323Y)
Ref Sequence ENSEMBL: ENSMUSP00000144368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167516] [ENSMUST00000201047]
Predicted Effect probably damaging
Transcript: ENSMUST00000167516
AA Change: H322Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126604
Gene: ENSMUSG00000091183
AA Change: H322Y

DomainStartEndE-ValueType
KRAB 3 65 2.32e-19 SMART
ZnF_C2H2 132 154 1.51e0 SMART
ZnF_C2H2 160 182 6.52e-5 SMART
ZnF_C2H2 188 210 5.42e-2 SMART
ZnF_C2H2 216 238 1.84e-4 SMART
ZnF_C2H2 244 266 1.3e-4 SMART
ZnF_C2H2 272 294 1.22e-4 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 328 350 2.79e-4 SMART
ZnF_C2H2 356 378 3.89e-3 SMART
ZnF_C2H2 384 406 4.94e-5 SMART
ZnF_C2H2 412 434 5.67e-5 SMART
ZnF_C2H2 440 462 7.49e-5 SMART
ZnF_C2H2 468 490 5.21e-4 SMART
ZnF_C2H2 496 518 4.87e-4 SMART
ZnF_C2H2 524 546 1.22e-4 SMART
ZnF_C2H2 552 574 1.18e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179519
Predicted Effect probably damaging
Transcript: ENSMUST00000201047
AA Change: H323Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144368
Gene: ENSMUSG00000091183
AA Change: H323Y

DomainStartEndE-ValueType
KRAB 4 66 9.8e-22 SMART
ZnF_C2H2 133 155 6.5e-3 SMART
ZnF_C2H2 161 183 2.7e-7 SMART
ZnF_C2H2 189 211 2.4e-4 SMART
ZnF_C2H2 217 239 8.1e-7 SMART
ZnF_C2H2 245 267 5.6e-7 SMART
ZnF_C2H2 273 295 5.1e-7 SMART
ZnF_C2H2 301 323 7.9e-6 SMART
ZnF_C2H2 329 351 1.2e-6 SMART
ZnF_C2H2 357 379 1.7e-5 SMART
ZnF_C2H2 385 407 2.1e-7 SMART
ZnF_C2H2 413 435 2.4e-7 SMART
ZnF_C2H2 441 463 3.2e-7 SMART
ZnF_C2H2 469 491 2.2e-6 SMART
ZnF_C2H2 497 519 2.2e-6 SMART
ZnF_C2H2 525 547 5.4e-7 SMART
ZnF_C2H2 553 575 4.9e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202582
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Gm5141
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0220:Gm5141 UTSW 13 62774457 missense probably damaging 1.00
R0427:Gm5141 UTSW 13 62774711 missense probably damaging 1.00
R0534:Gm5141 UTSW 13 62774594 missense probably damaging 1.00
R0652:Gm5141 UTSW 13 62774132 missense probably damaging 1.00
R1495:Gm5141 UTSW 13 62774270 missense probably damaging 1.00
R2079:Gm5141 UTSW 13 62774610 missense probably benign 0.06
R4780:Gm5141 UTSW 13 62774950 missense unknown
R5588:Gm5141 UTSW 13 62773770 missense probably benign 0.06
R6292:Gm5141 UTSW 13 62774438 missense probably damaging 1.00
R6455:Gm5141 UTSW 13 62774783 missense probably damaging 1.00
R7091:Gm5141 UTSW 13 62773964 missense possibly damaging 0.80
R7199:Gm5141 UTSW 13 62777063 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTGAAAAGGCTTTGTCACATTCAT -3'
(R):5'- AGCCTTTTCACATCATTGTAATCTTC -3'

Sequencing Primer
(F):5'- ACATTTGAAGGGTTTCTCTCCG -3'
(R):5'- GCCTTTTCAGAGAAAGGTAGTCTCC -3'
Posted On2018-06-22