Mutagenetix > Incidental Mutation

Incidental Mutation 'R6639:Dusp12'

525628

Institutional Source

Beutler Lab

Gene Symbol

Dusp12

Ensembl Gene

ENSMUSG00000026659

Gene Name

dual specificity phosphatase 12

Synonyms

T-DSP4, LMW-DSP4, VH1, 1190004O14Rik, ESTM36, mVH1

MMRRC Submission

044760-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6639 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

170701756-170713109 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 170708243 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 158 (E158G)

Ref Sequence

ENSEMBL: ENSMUSP00000027970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027970] [ENSMUST00000046476] [ENSMUST00000163252] [ENSMUST00000170420] [ENSMUST00000172042] [ENSMUST00000180542]

AlphaFold

Q9D0T2

Predicted Effect

probably damaging
Transcript: ENSMUST00000027970
AA Change: E158G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027970
Gene: ENSMUSG00000026659
AA Change: E158G

Domain	Start	End	E-Value	Type
DSPc	26	167	1.23e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000046476

SMART Domains

Protein: ENSMUSP00000044320
Gene: ENSMUSG00000026659

Domain	Start	End	E-Value	Type
DSPc	26	157	5.96e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163252

SMART Domains

Protein: ENSMUSP00000126676
Gene: ENSMUSG00000026659

Domain	Start	End	E-Value	Type
Pfam:DSPc	30	115	2e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166393

SMART Domains

Protein: ENSMUSP00000130507
Gene: ENSMUSG00000026659

Domain	Start	End	E-Value	Type
Pfam:DSPc	31	121	8.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170420

SMART Domains

Protein: ENSMUSP00000129515
Gene: ENSMUSG00000026659

Domain	Start	End	E-Value	Type
PTPc_DSPc	26	136	4e-4	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000171447
AA Change: E88G

SMART Domains

Protein: ENSMUSP00000130683
Gene: ENSMUSG00000026659
AA Change: E88G

Domain	Start	End	E-Value	Type
Pfam:DSPc	3	98	6.9e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171747

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172042
AA Change: E33G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000180542

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is the human ortholog of the Saccharomyces cerevisiae YVH1 protein tyrosine phosphatase. It is localized predominantly in the nucleus, and is novel in that it contains, and is regulated by a zinc finger domain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	T	G	10: 10,311,700 (GRCm39)	I238L	possibly damaging	Het
Ankrd33b	T	C	15: 31,297,818 (GRCm39)	Y313C	probably damaging	Het
Capn15	C	T	17: 26,179,152 (GRCm39)	V940I	probably benign	Het
Cdh3	G	C	8: 107,237,973 (GRCm39)	V56L	probably benign	Het
Cfap20dc	A	G	14: 8,536,530 (GRCm38)	S226P	probably benign	Het
Cfap57	T	C	4: 118,411,909 (GRCm39)	E1245G	probably benign	Het
Depdc7	C	T	2: 104,555,098 (GRCm39)	D271N	probably damaging	Het
Dmtn	T	C	14: 70,854,870 (GRCm39)	D10G	probably damaging	Het
Egf	C	T	3: 129,530,481 (GRCm39)	G227D	probably benign	Het
Epha1	C	A	6: 42,342,869 (GRCm39)	E227*	probably null	Het
Fbxo40	A	T	16: 36,790,937 (GRCm39)	C58S	probably damaging	Het
Focad	A	G	4: 88,196,479 (GRCm39)	T611A	unknown	Het
Fpr-rs4	C	T	17: 18,242,394 (GRCm39)	Q134*	probably null	Het
Fsip2	G	A	2: 82,813,571 (GRCm39)	D3297N	possibly damaging	Het
Garnl3	T	C	2: 32,879,537 (GRCm39)	R930G	possibly damaging	Het
Hdac4	A	T	1: 91,898,670 (GRCm39)	C695S	probably damaging	Het
Ier2	G	A	8: 85,388,791 (GRCm39)	T197M	probably benign	Het
Ift74	T	A	4: 94,552,496 (GRCm39)		probably benign	Het
Kat6b	A	G	14: 21,567,562 (GRCm39)	D207G	possibly damaging	Het
Khdrbs2	A	T	1: 32,506,943 (GRCm39)	R196*	probably null	Het
Naip6	C	A	13: 100,436,909 (GRCm39)	S538I	probably benign	Het
Nrip1	G	A	16: 76,090,883 (GRCm39)	Q225*	probably null	Het
Or14j3	A	G	17: 37,900,822 (GRCm39)	C141R	probably damaging	Het
Or1n2	G	A	2: 36,797,690 (GRCm39)	C244Y	probably damaging	Het
Pdrg1	T	C	2: 152,857,191 (GRCm39)	E17G	probably damaging	Het
R3hdm1	GAA	GAAA	1: 128,090,548 (GRCm39)		probably null	Het
Rnf17	C	T	14: 56,676,200 (GRCm39)	P354S	probably benign	Het
Sh3rf3	T	A	10: 58,919,289 (GRCm39)	Y469N	probably damaging	Het
Thoc6	T	A	17: 23,889,428 (GRCm39)		probably null	Het
Tpm3	C	G	3: 89,987,109 (GRCm39)	A24G	probably damaging	Het
Tuft1	T	C	3: 94,539,930 (GRCm39)	M93V	probably benign	Het
Vmn1r22	T	C	6: 57,877,699 (GRCm39)	I93V	probably benign	Het
Zfp383	T	C	7: 29,614,152 (GRCm39)	S136P	probably benign	Het
Zfp748	T	C	13: 67,691,024 (GRCm39)	K79E	probably damaging	Het

Other mutations in Dusp12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01104:Dusp12	APN	1	170,702,042 (GRCm39)	missense	probably damaging	1.00
IGL02718:Dusp12	APN	1	170,708,226 (GRCm39)	missense	probably damaging	1.00
P0028:Dusp12	UTSW	1	170,707,386 (GRCm39)	nonsense	probably null
R0040:Dusp12	UTSW	1	170,708,226 (GRCm39)	missense	probably damaging	1.00
R0040:Dusp12	UTSW	1	170,708,226 (GRCm39)	missense	probably damaging	1.00
R1114:Dusp12	UTSW	1	170,708,586 (GRCm39)	missense	probably damaging	1.00
R1833:Dusp12	UTSW	1	170,702,022 (GRCm39)	missense	probably benign
R1850:Dusp12	UTSW	1	170,708,198 (GRCm39)	missense	probably benign	0.12
R2138:Dusp12	UTSW	1	170,708,166 (GRCm39)	nonsense	probably null
R2260:Dusp12	UTSW	1	170,708,580 (GRCm39)	missense	probably damaging	1.00
R3972:Dusp12	UTSW	1	170,707,344 (GRCm39)	missense	probably damaging	0.98
R4298:Dusp12	UTSW	1	170,708,198 (GRCm39)	missense	probably benign	0.12
R4803:Dusp12	UTSW	1	170,708,175 (GRCm39)	missense	possibly damaging	0.51
R6674:Dusp12	UTSW	1	170,707,317 (GRCm39)	missense	probably benign	0.13
R6981:Dusp12	UTSW	1	170,708,530 (GRCm39)	missense	probably damaging	1.00
R7432:Dusp12	UTSW	1	170,707,345 (GRCm39)	nonsense	probably null
R7861:Dusp12	UTSW	1	170,702,095 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GACAGAATGCATTTAGTGTCCAAG -3'
(R):5'- AGGCTAAGTGAGTCCTCTGGAG -3'

Sequencing Primer
(F):5'- TTAGTGTCCAAGAAAATGACACCTCG -3'
(R):5'- GGAGTCCCAGTAATGCTTTTTC -3'

Posted On

2018-06-22